G84095



Basic Information


Item Value
gene id G84095
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 74926414 ~ 74926649 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU92775
ATTTCCTCCGACCCTCCACCAAACAATGAACGGTGAACACATTTTCTTTACACGGTGCCTCTGGATAGCGATAAGCTGAGCTCTGAACAATATCAATGCAGTTGATAGCATCAGACTGAATAGAGGAGGAACACCAAGGTTCAGCTCATACTTACCATGACGATGCCTCCAGACTGCTCCACTGTACACATGCTCATGATGGGGGCCATGCCAATGGTGGTACCCTGGAAGTACAC

Function


NR:

description
PREDICTED: disintegrin and metalloproteinase domain-containing protein 12-like isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU92775 True 236 lncRNA 0.48 1 74926414 74926649

Neighbor


gene id symbol gene type direction distance location
LOC110529307 LOC106577031 coding downstream 197568 74709330 ~ 74728846 (-)
LOC110529277 ptpre coding downstream 394789 74479938 ~ 74531625 (-)
gnrh3 NA coding downstream 448136 74477119 ~ 74478278 (-)
mgmt mgmt coding downstream 548260 74348790 ~ 74378154 (-)
LOC110529206 ppp2r2d coding downstream 692297 74229248 ~ 74234117 (-)
fank1 fank1 coding upstream 45123 74971772 ~ 74975108 (-)
edrf1 LOC106577037 coding upstream 55607 74982256 ~ 74996768 (-)
LOC110529369 LOC100380861 coding upstream 185992 75112641 ~ 75133272 (-)
LOC110529412 LOC106577039 coding upstream 208430 75135010 ~ 75148790 (-)
LOC110522123 LOC106577094 coding upstream 418464 75345113 ~ 75348344 (-)
G84094 NA non-coding downstream 226 74925949 ~ 74926188 (-)
G84092 NA non-coding downstream 5791 74920369 ~ 74920623 (-)
G84087 NA non-coding downstream 12708 74913462 ~ 74913706 (-)
G84085 NA non-coding downstream 16463 74909555 ~ 74909951 (-)
G84023 NA non-coding downstream 109524 74816395 ~ 74816890 (-)
G84102 NA non-coding upstream 9551 74936200 ~ 74936400 (-)
G84231 LOC106577038 non-coding upstream 179725 75106374 ~ 75107397 (-)
G84240 NA non-coding upstream 215854 75142503 ~ 75142712 (-)
G84241 NA non-coding upstream 216507 75143156 ~ 75143547 (-)
G83429 NA other downstream 353625 74572447 ~ 74572789 (-)
LOC110528794 LOC106576993 other downstream 2674496 72202814 ~ 72251918 (-)
G80957 NA other downstream 2715325 72207929 ~ 72211089 (-)
G79904 NA other downstream 3182605 71743045 ~ 71743809 (-)
G79700 NA other downstream 3455955 71469435 ~ 71470755 (-)
G84713 NA other upstream 601694 75528343 ~ 75528903 (-)
G85866 NA other upstream 1406819 76333468 ~ 76334136 (-)
ccser2a ccser2 other upstream 1440644 76324531 ~ 76399997 (-)
G86063 NA other upstream 1594436 76516251 ~ 76523481 (-)

Expression



Co-expression Network