G86614



Basic Information


Item Value
gene id G86614
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 77123935 ~ 77124427 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU95475
gtaaaagacacacgacagcctgcttggagttttccaaaaggcacctaaacgactctcagatcatgagaaacaagattctctggtctgatgaaaccaagattgaactatttggcctcaatgccaagcgtcaggtctggaggaaacctggcaccatcactgccatgaagcatggtggtggcagaatcatgctgtggggatgtttttcagaggcagggactgggagactagtcaggatcgagagaaagatgaatggagcaaagtacagagagatccttgatgaaaacctgctccagggtgctcaggacctcagactggggtgaaggttcaccttccaacaggacaacaaccctaagcacacagccaagacaacacaggagtggctttgggacaagtctctgaatgtcattgagtggcccagccagagcctggacttgaacccaatcgaacatctctggagagacctgaaaatggctgtgcagcaacgcttcccatc

Function


NR:

description
TC1-like transposase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU95475 True 493 TUCP 0.43 1 77123935 77124427

Neighbor


gene id symbol gene type direction distance location
LOC110529780 LOC106577069 coding upstream 75583 77027460 ~ 77048352 (+)
LOC110529720 NA coding upstream 108563 76943550 ~ 77015372 (+)
LOC110529711 LOC106607701 coding upstream 185071 76935475 ~ 76938864 (+)
LOC110532693 LOC106577081 coding upstream 259713 76812280 ~ 76864222 (+)
LOC118966716 NA coding upstream 314370 76806285 ~ 76809565 (+)
LOC118965545 NA coding downstream 162562 77286989 ~ 77287694 (+)
LOC100136692 cdc2 coding downstream 215227 77339654 ~ 77345543 (+)
LOC110529906 LOC106577140 coding downstream 257431 77381858 ~ 77451342 (+)
LOC110529921 LOC106577139 coding downstream 336453 77460880 ~ 77468921 (+)
LOC110529936 aedo coding downstream 358057 77482484 ~ 77484050 (+)
G86593 NA non-coding upstream 24701 77098858 ~ 77099234 (+)
G86588 NA non-coding upstream 33697 77090020 ~ 77090238 (+)
G86579 NA non-coding upstream 52597 77071124 ~ 77071338 (+)
G86575 NA non-coding upstream 55531 77068182 ~ 77068404 (+)
G86565 LOC100136012 non-coding upstream 88277 77034379 ~ 77035658 (+)
G86619 NA non-coding downstream 19306 77143733 ~ 77143965 (+)
G86559 NA non-coding downstream 26561 77150988 ~ 77153726 (+)
G86937 LOC106577143 non-coding downstream 230057 77354484 ~ 77354871 (+)
G86938 NA non-coding downstream 232040 77356467 ~ 77356784 (+)
G86939 NA non-coding downstream 232823 77357250 ~ 77357637 (+)
G86019 NA other upstream 487999 76631745 ~ 76635936 (+)
LOC110529610 NA other upstream 664112 76457821 ~ 76459823 (+)
G83979 NA other upstream 1978423 75144864 ~ 75145512 (+)
G83829 NA other upstream 2009745 75112660 ~ 75114190 (+)
G83836 NA other upstream 2214129 74909225 ~ 74909806 (+)
G87159 NA other downstream 445588 77570015 ~ 77570470 (+)
G89667 NA other downstream 2424590 79549017 ~ 79549651 (+)
acoxl acoxl other downstream 2627346 79720751 ~ 79765359 (+)
G91064 NA other downstream 3640687 80765114 ~ 80766155 (+)
G91541 LOC106591086 other downstream 4413904 81538331 ~ 81541400 (+)

Expression


G86614 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G86614 Expression in each Bioproject

Bar chart with 20 bars.
G86614 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network