G90089



Basic Information


Item Value
gene id G90089
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 79550836 ~ 79551279 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU99213
atgttaatgcgagtgtagtgaaatgcttgtgcttctagttccaacaatgcagtaataaccaacgagtaatctaacctaacaattacaaaactactaccttatacacacaagtgtaaagggataaagaatatgtacataaagatatgaatgagtgatggtacagaacggcataggcaagatgcagtagatggtatcgagtacagtatatacatatgagatgagtaatgtagggtatgtaaacaaagtggcatagttaaagtggctagtgatacatgtattacataaagatgcagtagatgatatagagtacagtatatacaaatacatatgagatgagtaatgtagggtattgaaacattatattaagtagcattgtttaaagtggctagtgatatattttacatcaattcccatcaatttccattattaaagtggctgtagttg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU99213 True 444 lncRNA 0.33 1 79550836 79551279
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110530138 LOC100380625 coding downstream 55666 79361597 ~ 79495170 (-)
LOC110530112 LOC106577113 coding downstream 199432 79257290 ~ 79351404 (-)
LOC110530107 rps27a coding downstream 338268 79209864 ~ 79212568 (-)
LOC110530099 LOC106577117 coding downstream 341637 79207502 ~ 79209199 (-)
LOC110530078 pnpt1 coding downstream 441499 79093139 ~ 79109337 (-)
LOC100136270 LOC106577110 coding upstream 61358 79612637 ~ 79692579 (-)
LOC110530200 NA coding upstream 310802 79862081 ~ 79917875 (-)
mtrf1l mtrf1l coding upstream 384543 79935822 ~ 79946936 (-)
LOC110530250 LOC106577100 coding upstream 484007 80035286 ~ 80058352 (-)
LOC110530258 LOC106577097 coding upstream 521291 80072570 ~ 80138452 (-)
G90080 NA non-coding downstream 16362 79534219 ~ 79534474 (-)
G90077 NA non-coding downstream 18942 79531686 ~ 79531894 (-)
G90076 NA non-coding downstream 21322 79529223 ~ 79529514 (-)
G90074 NA non-coding downstream 23004 79527574 ~ 79527832 (-)
G90070 NA non-coding downstream 31351 79519083 ~ 79519485 (-)
G90092 NA non-coding upstream 4823 79556102 ~ 79556323 (-)
G90094 NA non-coding upstream 6058 79557337 ~ 79557819 (-)
G90104 NA non-coding upstream 19535 79570814 ~ 79571028 (-)
G90117 NA non-coding upstream 29092 79580371 ~ 79580571 (-)
G90132 NA non-coding upstream 46831 79598110 ~ 79598473 (-)
G90081 NA other downstream 15264 79534758 ~ 79535572 (-)
G89418 NA other downstream 500345 79049811 ~ 79050491 (-)
G87090 NA other downstream 2070897 77478603 ~ 77479939 (-)
G86448 NA other downstream 2683238 76866904 ~ 76867598 (-)
G86132 LOC106577062 other downstream 2942482 76606682 ~ 76608354 (-)
G90190 NA other upstream 335396 79886675 ~ 79888180 (-)
G90382 NA other upstream 590280 80141559 ~ 80142157 (-)
nphp1 LOC106577164 other upstream 1389445 80940215 ~ 80966643 (-)
G91941 NA other upstream 1476629 81027908 ~ 81028612 (-)

Expression


G90089 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G90089 Expression in each Bioproject

Bar chart with 20 bars.
G90089 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network