G90205


Basic Information

Item Value
gene id G90205
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 79677856 ~ 79738682 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU99342
aaaaaaaatccagaaaatcacattgtaggatttttaatgaatttgcaaattatggtggaaaataagtatttggtcaataacaaaagtttatctcaatactttgttatataccctttgttggcaatgacagaggtcaaacgttttctgtaagtcttcaaggttttcatacactgttgctggtattttggcccattcctccatgcagatctcctctagagcagtgatgttttgggtcttttgctgggcaacacagactttcaactccctccaaagattttctgtggggttgagatctggagactggctaggccattccaggaccttgaaatgcttcttacgaagccactccttcgttgcccgggcggtgtgtttgggatcattgtcatgctgaaagacccagccatgtttcatcttcaatgcccttgctgatggaaggaggttttcactcaaaatctcacgatacatggccccattaattatttcctttacacggatcagtcgtcctggtccctttgcagaaaaatagccccaaagcatgatgtttccacccccatgcttcacagtaggtatggtgttctttggatgcaactcagcattctttgtcctccaaacacgacgagttaagtttttaccaaaaagttatattttggtttcatctgaccatatgacattggggcggcagggtagcctagtgtttagagtgcttgtttgtaggtgaccaaatacttat

Function

NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA

RNA id representative length rna type GC content exon number start site end site
TU99342 True 730 lncRNA 0.42 2 79677856 79738682
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110530138 LOC100380625 coding downstream 182686 79361597 ~ 79495170 (-)
LOC110530112 LOC106577113 coding downstream 326452 79257290 ~ 79351404 (-)
LOC110530107 rps27a coding downstream 465288 79209864 ~ 79212568 (-)
LOC110530099 LOC106577117 coding downstream 468657 79207502 ~ 79209199 (-)
LOC110530078 pnpt1 coding downstream 568519 79093139 ~ 79109337 (-)
LOC110530200 NA coding upstream 123399 79862081 ~ 79917875 (-)
mtrf1l mtrf1l coding upstream 197140 79935822 ~ 79946936 (-)
LOC110530250 LOC106577100 coding upstream 296604 80035286 ~ 80058352 (-)
LOC110530258 LOC106577097 coding upstream 333888 80072570 ~ 80138452 (-)
LOC110530266 LOC106577153 coding upstream 482334 80221016 ~ 80236430 (-)
G90137 NA non-coding downstream 72576 79605007 ~ 79605280 (-)
G90132 NA non-coding downstream 79383 79598110 ~ 79598473 (-)
G90117 NA non-coding downstream 97285 79580371 ~ 79580571 (-)
G90104 NA non-coding downstream 106828 79570814 ~ 79571028 (-)
G90094 NA non-coding downstream 120037 79557337 ~ 79557819 (-)
G90260 LOC106577104 non-coding upstream 187533 79926215 ~ 79928905 (-)
G90291 NA non-coding upstream 222508 79961190 ~ 79989614 (-)
G90271 NA non-coding upstream 415149 80153831 ~ 80157631 (-)
G90406 NA non-coding upstream 446459 80185141 ~ 80185438 (-)
G90081 NA other downstream 142284 79534758 ~ 79535572 (-)
G89418 NA other downstream 627365 79049811 ~ 79050491 (-)
G87090 NA other downstream 2197917 77478603 ~ 77479939 (-)
G86448 NA other downstream 2810258 76866904 ~ 76867598 (-)
G86132 LOC106577062 other downstream 3069502 76606682 ~ 76608354 (-)
G90190 NA other upstream 147993 79886675 ~ 79888180 (-)
G90382 NA other upstream 402877 80141559 ~ 80142157 (-)
nphp1 LOC106577164 other upstream 1202042 80940215 ~ 80966643 (-)
G91941 NA other upstream 1289226 81027908 ~ 81028612 (-)

Expression

G90205 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G90205 Expression in each Bioproject

Bar chart with 21 bars.
G90205 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network