XLOC_020356 (fgf22)


Basic Information

Item Value
gene id XLOC_020356
gene name fgf22
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007133.7
NCBI id CM002906.2
chromosome length 39133080
location 19111444 ~ 19156332 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00040412
ATGTGCAAATGGACACCTACTACCGCTGGTCTCCACTTCGCTGGCTCAGCCCCCCCTTCTTATCCTGCTACCCTGGTATGCTTGTCCCTACTCTCTCTGGCTTGCTCTGCTCTTGGAGGTTGCCCACCTGCACTGGGGCATGACCCCCTACATGCGCTGGCACAAGGGACAAACTGCTCGTGGACTCTGGAGCGGCACACACGCAGCTATAACCACCTCGAGGGTGACGTTCGCCTGCGACGCCTCTATTCTGCCAACAAGTTCTTTCTCTGCATCGACAAGACGGGCAAGGTGGATGGCACACGTCGGAAAAATTACGCTGACAGTCTGATGGAAATCCGATCTGTCAGTGTGGGAGTTGTCGCCATCAAATCTGTCAGCACCGGCCTGTACTTAGCTATGTCCAAAAAGGGAACACTCTTCGGATCGGCCAGATACAACCCCAGCTGCAAGTTCAAAGAGCGGATTGAAGAGAACGGCTATAACACTTACGCCTCTCTGCGCTGGAAGCACAGGGGGAGGCAGATGTTTGTGTCACTGAACGGCCGAGGAAAACCCCGCAGAGGTCACAAAGCTAGACGGAGACACCCATCTACTCATTTCCTCCCAATGCTGCCCACATAG

Function

symbol description
fgf22 Predicted to enable fibroblast growth factor receptor binding activity and growth factor activity. Acts upstream of or within cell proliferation in midbrain; midbrain-hindbrain boundary development; and roof plate formation. Predicted to be located in extracellular region. Predicted to be active in cytoplasm. Is expressed in midbrain; midbrain hindbrain boundary; midbrain hindbrain boundary neural rod; otic vesicle; and telencephalon. Orthologous to human FGF22 (fibroblast growth factor 22).

GO:

id name namespace
GO:0010628 positive regulation of gene expression biological_process
GO:0030154 cell differentiation biological_process
GO:0009887 animal organ morphogenesis biological_process
GO:0008543 fibroblast growth factor receptor signaling pathway biological_process
GO:0008284 positive regulation of cell population proliferation biological_process
GO:0033278 cell proliferation in midbrain biological_process
GO:0001934 positive regulation of protein phosphorylation biological_process
GO:0030901 midbrain development biological_process
GO:0030334 regulation of cell migration biological_process
GO:0030917 midbrain-hindbrain boundary development biological_process
GO:0021509 roof plate formation biological_process
GO:0005576 extracellular region cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005104 fibroblast growth factor receptor binding molecular_function
GO:0008083 growth factor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050208-380 Predicted to enable fibroblast growth factor receptor binding activity and growth factor activity. Acts upstream of or within cell proliferation in midbrain; midbrain-hindbrain boundary development; and roof plate formation. Predicted to be located in extracellular region. Predicted to be active in cytoplasm. Is expressed in midbrain; midbrain hindbrain boundary; midbrain hindbrain boundary neural rod; otic vesicle; and telencephalon. Orthologous to human FGF22 (fibroblast growth factor 22).

Ensembl:

ensembl_id ENSDARG00000076510

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00040412 True 624 mRNA 0.55 3 19111444 19156332

Neighbor

gene id symbol gene type direction distance location
XLOC_020355 hcn2b coding upstream 103476 18951096 ~ 19007968 (+)
XLOC_020354 bsg coding upstream 164991 18929412 ~ 18946453 (+)
XLOC_020353 fstl3 coding upstream 214213 18884971 ~ 18897231 (+)
XLOC_020352 cbarpb coding upstream 286643 18786797 ~ 18824801 (+)
XLOC_020351 NA coding upstream 515186 18560343 ~ 18596258 (+)
XLOC_020357 si:dkey-21e2.3 coding downstream 19319 19175651 ~ 19183506 (+)
XLOC_020358 si:dkey-21e2.8 coding downstream 32477 19188809 ~ 19268280 (+)
XLOC_020359 si:dkey-21e2.7 coding downstream 62401 19218733 ~ 19233919 (+)
XLOC_020360 BX927243.1 coding downstream 80699 19237031 ~ 19238226 (+)
XLOC_020361 si:dkey-21e2.10 coding downstream 90923 19247255 ~ 19250734 (+)
XLOC_020344 NA non-coding upstream 807156 18243758 ~ 18304288 (+)
XLOC_020345 NA non-coding upstream 819647 18291474 ~ 18291797 (+)
XLOC_020339 BX908731.2 non-coding upstream 1286871 17824459 ~ 17824573 (+)
XLOC_020324 NA non-coding upstream 2300083 16810284 ~ 16811361 (+)
XLOC_020380 BX510913.2 non-coding downstream 615366 19771698 ~ 19771812 (+)
XLOC_020381 BX510913.3 non-coding downstream 636787 19793119 ~ 19793233 (+)
XLOC_020382 NA non-coding downstream 682943 19839275 ~ 19839592 (+)
XLOC_020383 NA non-coding downstream 855464 20011796 ~ 20050276 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
bowfin (Amia calva) AMCG00005892 fgf22,LOC106584266 coding CM030142.1 CM030142.1 12170080 ~ 12171314 (+)