G96719



Basic Information


Item Value
gene id G96719
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 86690611 ~ 86696733 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU106838
gtcatctacctacgttatataggtatgtacatcatctacctacgttatataggtatgtaggtcatctacctacgttatataggtatgtacgtcatctacctacgttatataggtatgtacgtcatctacctacgttatataggtatgtacgtcatctacctacgttatataggtatgtacgtcatctacctacgttatat

Function


NR:

description
putative uncharacterized protein DDB_G0290521

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU106838 True 200 lncRNA 0.34 2 86690611 86696733
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118966035 LOC106592896 coding upstream 95040 86562981 ~ 86595571 (+)
LOC118966726 NA coding upstream 131348 86557726 ~ 86559263 (+)
LOC118966725 NA coding upstream 136956 86537425 ~ 86553655 (+)
LOC118966033 LOC106562881 coding upstream 194882 86492069 ~ 86495729 (+)
LOC118966031 NA coding upstream 209923 86473391 ~ 86480688 (+)
LOC110531632 slc1a4 coding downstream 40151 86736884 ~ 86756777 (+)
LOC110516875 LOC106577366 coding downstream 67554 86764287 ~ 86783717 (+)
LOC100135993 LOC100135993 coding downstream 674050 87370783 ~ 87373089 (+)
LOC118966047 adgrb3 coding downstream 779771 87476504 ~ 87645037 (+)
LOC118966730 NA coding downstream 952196 87648929 ~ 87661492 (+)
G96695 LOC106592896 non-coding upstream 2695 86642904 ~ 86687916 (+)
G96693 NA non-coding upstream 4036 86639557 ~ 86686575 (+)
G96717 NA non-coding upstream 11042 86677086 ~ 86679569 (+)
G96708 NA non-coding upstream 20349 86669036 ~ 86670262 (+)
G96690 NA non-coding upstream 49155 86632449 ~ 86641456 (+)
G96725 NA non-coding downstream 35649 86732382 ~ 86734815 (+)
G96726 NA non-coding downstream 38496 86735229 ~ 86735618 (+)
G96727 NA non-coding downstream 39112 86735845 ~ 86736045 (+)
G96731 NA non-coding downstream 62149 86758882 ~ 86760019 (+)
G96732 NA non-coding downstream 64439 86761172 ~ 86761485 (+)
G96630 LOC106592896 other upstream 229769 86460228 ~ 86572480 (+)
LOC118966024 LOC106562881 other upstream 251139 86420114 ~ 86443279 (+)
G96577 NA other upstream 277399 86411207 ~ 86413212 (+)
G96133 NA other upstream 1052556 85637747 ~ 85638055 (+)
G97752 NA other downstream 1060308 87757041 ~ 87757546 (+)
LOC118966052 LOC106577294 other downstream 1224274 87920968 ~ 87928366 (+)
G98104 NA other downstream 1434305 88130944 ~ 88165405 (+)
LOC118966060 LOC106613898 other downstream 1940317 88608182 ~ 88744413 (+)
LOC118966061 NA other downstream 1944280 88551971 ~ 88647803 (+)

Expression


G96719 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G96719 Expression in each Bioproject

Bar chart with 11 bars.
G96719 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network