G96726



Basic Information


Item Value
gene id G96726
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 86735229 ~ 86735618 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU106846
atgtgggtagtgatgcaccccagcattatgtagtttaactatgtgggtagtgttgcaccccagcattatgtagtttaactatgtgggtagtgaaccaccccagcattatgtagtttaactatgtgggtagtgatgcaccccagcattatgtagtttaactatgtgggtagtgatgcaccccagcattatgtagtttaactatgtgggtagtgaaccaccccagcattatgtagtttaactatgtgggtagtgatgcaccccagcattatgtagtttaactatgtgggtagtgttgcaccccagcattatgtagtttaactatgtgggtagtgatgcaccccagcattatgtagtttaactatgtgggtagtgttgcaccccagcattatg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU106846 True 390 lncRNA 0.50 1 86735229 86735618

Neighbor


gene id symbol gene type direction distance location
LOC118966035 LOC106592896 coding upstream 139658 86562981 ~ 86595571 (+)
LOC118966726 NA coding upstream 175966 86557726 ~ 86559263 (+)
LOC118966725 NA coding upstream 181574 86537425 ~ 86553655 (+)
LOC118966033 LOC106562881 coding upstream 239500 86492069 ~ 86495729 (+)
LOC118966031 NA coding upstream 254541 86473391 ~ 86480688 (+)
LOC110531632 slc1a4 coding downstream 1266 86736884 ~ 86756777 (+)
LOC110516875 LOC106577366 coding downstream 28669 86764287 ~ 86783717 (+)
LOC100135993 LOC100135993 coding downstream 635165 87370783 ~ 87373089 (+)
LOC118966047 adgrb3 coding downstream 740886 87476504 ~ 87645037 (+)
LOC118966730 NA coding downstream 913311 87648929 ~ 87661492 (+)
G96725 NA non-coding upstream 414 86732382 ~ 86734815 (+)
G96719 NA non-coding upstream 38496 86690611 ~ 86696733 (+)
G96718 NA non-coding upstream 39049 86690002 ~ 86696180 (+)
G96695 LOC106592896 non-coding upstream 47313 86642904 ~ 86687916 (+)
G96727 NA non-coding downstream 227 86735845 ~ 86736045 (+)
G96731 NA non-coding downstream 23264 86758882 ~ 86760019 (+)
G96732 NA non-coding downstream 25554 86761172 ~ 86761485 (+)
G96734 NA non-coding downstream 38857 86774475 ~ 86774929 (+)
G96740 NA non-coding downstream 54286 86789904 ~ 86790129 (+)
G96630 LOC106592896 other upstream 274387 86460228 ~ 86572480 (+)
LOC118966024 LOC106562881 other upstream 295757 86420114 ~ 86443279 (+)
G96577 NA other upstream 322017 86411207 ~ 86413212 (+)
G96133 NA other upstream 1097174 85637747 ~ 85638055 (+)
G97752 NA other downstream 1021423 87757041 ~ 87757546 (+)
LOC118966052 LOC106577294 other downstream 1185389 87920968 ~ 87928366 (+)
G98104 NA other downstream 1395420 88130944 ~ 88165405 (+)
LOC118966060 LOC106613898 other downstream 1901432 88608182 ~ 88744413 (+)
LOC118966061 NA other downstream 1905395 88551971 ~ 88647803 (+)

Expression


G96726 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G96726 Expression in each Bioproject

Bar chart with 15 bars.
G96726 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network