G98502 (actr2a)



Basic Information


Item Value
gene id G98502
gene name actr2a
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 88210961 ~ 88212201 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU109103
GTCTCAAACATCACCTCGATGATCTTCTCTCGGTTCTTGGTGGGGTTCATGGGCGGCTCGGTGAGCAGGATCTTGCAGTTCCTGGAGTCGATGTTGAGCTTCTCAGGCCCGAAGGTGTAGTCCCACAGGTGCTTCATGTCGTCCCAGTTCCTGACGATGCCGTTCTCCATGGGGTAGTTGACCTCTAGCATGGAGCGCAGCTCGCTGGCCTCGTCGCCCACCATCAG

Function


symbol description
actr2a Predicted to enable ATP binding activity and actin binding activity. Predicted to contribute to actin filament binding activity. Predicted to be involved in Arp2/3 complex-mediated actin nucleation; positive regulation of double-strand break repair via homologous recombination; and positive regulation of transcription by RNA polymerase II. Predicted to act upstream of or within actin filament organization. Predicted to be located in cytoplasm; nucleus; and site of double-strand break. Predicted to be part of Arp2/3 protein complex. Predicted to be active in actin cortical patch. Orthologous to human ACTR2 (actin related protein 2).

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU109103 True 227 lncRNA 0.40 2 88210961 88212201

Neighbor


gene id symbol gene type direction distance location
papolg papolg coding downstream 8803 88178952 ~ 88202158 (-)
LOC118966733 NA coding downstream 46350 88159117 ~ 88164611 (-)
LOC100499622 alb1 coding downstream 66495 88131038 ~ 88144466 (-)
LOC118936685 LOC106577316 coding downstream 86234 88092044 ~ 88124727 (-)
pex13 LOC106592834 coding downstream 145838 88054545 ~ 88065123 (-)
LOC118966057 NA coding upstream 15687 88224741 ~ 88230342 (-)
LOC118966058 NA coding upstream 19740 88231941 ~ 88234672 (-)
LOC118936686 LOC106594327 coding upstream 24380 88236581 ~ 88270980 (-)
LOC118966063 NA coding upstream 502672 88714598 ~ 88715755 (-)
LOC118966064 NA coding upstream 504117 88716318 ~ 88717077 (-)
G98501 NA non-coding downstream 6352 88204290 ~ 88204609 (-)
G98499 NA non-coding downstream 13030 88197610 ~ 88197931 (-)
G98488 NA non-coding downstream 43649 88165837 ~ 88167312 (-)
G98478 NA non-coding downstream 96679 88111666 ~ 88114282 (-)
G98473 NA non-coding downstream 108708 88101473 ~ 88102253 (-)
G98505 NA non-coding upstream 11130 88223331 ~ 88224678 (-)
G98514 NA non-coding upstream 25799 88238000 ~ 88238331 (-)
G98522 NA non-coding upstream 41545 88253746 ~ 88254060 (-)
LOC110531505 LOC106597820 other downstream 295061 87911053 ~ 87919678 (-)
G97535 NA other downstream 915962 87294357 ~ 87294999 (-)
G97308 NA other downstream 1422909 86787057 ~ 86788052 (-)
G97251 NA other downstream 1587650 86566477 ~ 86623311 (-)
G98510 NA other upstream 6628 88218829 ~ 88220804 (-)
G98549 NA other upstream 102075 88314276 ~ 88314696 (-)
G98616 NA other upstream 339773 88551974 ~ 88644067 (-)
LOC118966065 NA other upstream 565338 88757265 ~ 88782119 (-)
G98878 NA other upstream 863646 89075847 ~ 89076238 (-)

Expression



Co-expression Network