G98854



Basic Information


Item Value
gene id G98854
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 89030026 ~ 89030264 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU109531
TCCCAGAACAGAGCAAGACACAGATGAGTATGTTTGAAGATTCTGTTTTGAAAGTTGTCTTTATTTTTATATACATGGAACTAGCAGCACCTCAGGCAGCGTGATACATCCAGACAGACGATATCTTTGAATTGAGCCCTTTTTCTCTTGGTTACCGCAGGCCCTGTGTTGTGGATTGAATGTGGTTGGAAACCATGAGAACCGGAATGGAGGATCCCATCCATGTGTAACTAAAGCAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU109531 True 239 lncRNA 0.43 1 89030026 89030264

Neighbor


gene id symbol gene type direction distance location
LOC118966069 NA coding upstream 9426 89018704 ~ 89020600 (+)
si:dkey-78p8.1 LOC106577363 coding upstream 11756 89007456 ~ 89018305 (+)
LOC110518194 LOC106577299 coding upstream 37566 88981098 ~ 88992460 (+)
LOC118966734 NA coding upstream 199774 88829551 ~ 88830252 (+)
LOC118966059 NA coding upstream 301833 88725598 ~ 88728193 (+)
LOC110510724 chst3 coding downstream 240544 89270808 ~ 89288624 (+)
LOC110514249 LOC101463634 coding downstream 558101 89588365 ~ 89663139 (+)
LOC118966071 NA coding downstream 627113 89657377 ~ 89659317 (+)
gpx9 LOC106577309 coding downstream 773644 89803908 ~ 89806519 (+)
LOC110531574 LOC106577308 coding downstream 777012 89807276 ~ 89813481 (+)
G98853 NA non-coding upstream 287 89029138 ~ 89029739 (+)
G98851 NA non-coding upstream 2932 89026807 ~ 89027094 (+)
G98847 NA non-coding upstream 6947 89022794 ~ 89023079 (+)
G98837 NA non-coding upstream 8434 89020958 ~ 89021592 (+)
G98862 NA non-coding downstream 7419 89037683 ~ 89037978 (+)
G98870 NA non-coding downstream 24050 89054314 ~ 89054806 (+)
G98874 NA non-coding downstream 33213 89063477 ~ 89063736 (+)
G98877 NA non-coding downstream 45572 89075836 ~ 89076256 (+)
G98892 NA non-coding downstream 63551 89093815 ~ 89094047 (+)
LOC118966060 LOC106613898 other upstream 285613 88608182 ~ 88744413 (+)
LOC118966062 NA other upstream 380232 88646294 ~ 88649794 (+)
LOC118966061 NA other upstream 386575 88551971 ~ 88647803 (+)
G98104 NA other upstream 885585 88130944 ~ 88165405 (+)
LOC118966052 LOC106577294 other upstream 1107612 87920968 ~ 87928366 (+)
G99160 NA other downstream 428471 89458735 ~ 89459071 (+)
G99246 NA other downstream 628997 89659261 ~ 89663140 (+)
G99440 NA other downstream 809604 89839868 ~ 89841791 (+)
G99466 NA other downstream 877508 89907772 ~ 89908434 (+)

Expression


G98854 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G98854 Expression in each Bioproject

Bar chart with 3 bars.
G98854 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network