G99160



Basic Information


Item Value
gene id G99160
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 89458735 ~ 89459071 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU109864
GTCAACTGGTTCCAACAGCATCACCAAATGCTACTGCAGTCAATTGGTTGCAACAGCATCACCAAATGCTACTGCAGTCAACTGGTTCCAACAGCATCACCAAATGCTACAGCAGTCAACTGGTTTCAACAGCATCACCAAATGCTACAGCAGTCAACTGGTTCCAACAGCATCCCCAAATGCTACAGCAGTCAACTGGTTCCAACAGCATCACCAAATGTTACATCAGTCAACTGGTTGCAACAGCATCACCAAATGCTACAGCAGTCAACTGGTTCCAACAGCATCACCAAATGCTACAGCAGTCAACTGGTTCCAACAGCATCACCAAATGCTA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU109864 True 337 TUCP 0.46 1 89458735 89459071
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110510724 chst3 coding upstream 170111 89270808 ~ 89288624 (+)
LOC118966069 NA coding upstream 438135 89018704 ~ 89020600 (+)
si:dkey-78p8.1 LOC106577363 coding upstream 440465 89007456 ~ 89018305 (+)
LOC110518194 LOC106577299 coding upstream 466275 88981098 ~ 88992460 (+)
LOC118966734 NA coding upstream 628483 88829551 ~ 88830252 (+)
LOC110514249 LOC101463634 coding downstream 129294 89588365 ~ 89663139 (+)
LOC118966071 NA coding downstream 198306 89657377 ~ 89659317 (+)
gpx9 LOC106577309 coding downstream 344837 89803908 ~ 89806519 (+)
LOC110531574 LOC106577308 coding downstream 348205 89807276 ~ 89813481 (+)
LOC118936687 LOC106577393 coding downstream 361304 89820375 ~ 89845196 (+)
G99157 NA non-coding upstream 859 89455019 ~ 89457876 (+)
G99153 NA non-coding upstream 5091 89453294 ~ 89453644 (+)
G99144 NA non-coding upstream 19241 89438768 ~ 89439494 (+)
G99124 NA non-coding upstream 41493 89416902 ~ 89417242 (+)
G99123 NA non-coding upstream 43464 89415005 ~ 89415271 (+)
G99161 NA non-coding downstream 147 89459218 ~ 89459518 (+)
G99163 NA non-coding downstream 3274 89462345 ~ 89462562 (+)
G99166 NA non-coding downstream 7415 89466486 ~ 89466708 (+)
G99179 NA non-coding downstream 24061 89483132 ~ 89483370 (+)
G99180 NA non-coding downstream 26978 89486049 ~ 89486271 (+)
LOC118966060 LOC106613898 other upstream 714322 88608182 ~ 88744413 (+)
LOC118966062 NA other upstream 808941 88646294 ~ 88649794 (+)
LOC118966061 NA other upstream 815284 88551971 ~ 88647803 (+)
G98104 NA other upstream 1314294 88130944 ~ 88165405 (+)
G99246 NA other downstream 200190 89659261 ~ 89663140 (+)
G99440 NA other downstream 380797 89839868 ~ 89841791 (+)
G99466 NA other downstream 448701 89907772 ~ 89908434 (+)
G99470 NA other downstream 456009 89915080 ~ 89918120 (+)
G99484 NA other downstream 490368 89949439 ~ 89950884 (+)

Expression


G99160 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G99160 Expression in each Bioproject

Bar chart with 4 bars.
G99160 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network