G100391



Basic Information


Item Value
gene id G100391
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 90938726 ~ 90939404 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU111646
cactgagcagcactccccctactgtattacctcagcactccccctactgtattacctcacactgagcagcactccccctactgtattacctcacgctgagcagcactccccctactgtattacctcacgctgagcagcactccccctactgtattacctcagcactccccctactgtattacctcacactgagcagcactccccctactgtattacctcacgctgagcagcactccccctactgtattacctcagcactccccctactgtattacctcacgctgagcagcactccccctactgtattacctcacgctgagcagcactccccctactgt

Function


NR:

description
transposase-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU111646 True 338 lncRNA 0.55 2 90938726 90939404
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110513773 LOC107083051 coding downstream 124795 90803324 ~ 90813931 (-)
LOC118966739 LOC106577420 coding downstream 190335 90746652 ~ 90748391 (-)
LOC118966738 LOC106594844 coding downstream 192120 90745393 ~ 90746606 (-)
LOC118966737 LOC106577420 coding downstream 241791 90695281 ~ 90696935 (-)
LOC118966736 LOC106585883 coding downstream 243493 90693579 ~ 90695233 (-)
LOC110516041 jakmip3 coding upstream 43863 90982735 ~ 91072716 (-)
LOC110531579 LOC106577354 coding upstream 151007 91090411 ~ 91119379 (-)
LOC118966091 tcerg1l coding upstream 377764 91317168 ~ 91530447 (-)
LOC110531398 glrx3 coding upstream 854214 91791792 ~ 91832379 (-)
LOC118966740 NA coding upstream 1604485 92543889 ~ 92544887 (-)
G100384 NA non-coding downstream 18872 90919564 ~ 90919854 (-)
G100296 NA non-coding downstream 20035 90918415 ~ 90918691 (-)
G100291 LOC106577418 non-coding downstream 26839 90910951 ~ 90911887 (-)
G100288 NA non-coding downstream 29380 90908489 ~ 90909346 (-)
G100282 NA non-coding downstream 40673 90895687 ~ 90898053 (-)
G100396 NA non-coding upstream 28250 90967654 ~ 90968153 (-)
G100400 NA non-coding upstream 53732 90993136 ~ 90993693 (-)
G100403 NA non-coding upstream 61005 91000409 ~ 91007906 (-)
G100426 NA non-coding upstream 107564 91046968 ~ 91047820 (-)
G100430 NA non-coding upstream 113300 91052704 ~ 91053040 (-)
G100197 NA other downstream 79754 90625080 ~ 90858972 (-)
G99602 NA other downstream 974521 89963873 ~ 89964205 (-)
G99595 NA other downstream 980810 89957392 ~ 89957916 (-)
G99035 NA other downstream 1648670 89287214 ~ 89290056 (-)
ghitm LOC100136239 other downstream 1686638 89223150 ~ 89270371 (-)
G100582 NA other upstream 293336 91232740 ~ 91233788 (-)
G102060 NA other upstream 1652177 92591581 ~ 92595514 (-)
G102083 NA other upstream 1697894 92637298 ~ 92638881 (-)

Expression


G100391 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G100391 Expression in each Bioproject

Bar chart with 20 bars.
G100391 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network