G100415



Basic Information


Item Value
gene id G100415
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 91085890 ~ 91086540 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU111687
TTCACATAGACACTTGACATGTTGACCAGCTCTACAAGACATGCAGAAACAGATTGGTAAATGCCTCTTCAAGGCATAACTCAGGAAAGCCTCTGTTGCTCTCTTCATTCTTAGAACAAAAACATACTGAAGCATTCTGGATACTGAGATTTCGTATTTAATTAGGAGTGAAGTATAAGTAAGGCAAAATAAGATATTTCTAAATTCCCTCATGATTACAAGCGTGAAAGTCTATATTTTCCCCTAAAATATTTGATATGGGGATGTGTGGTCTTATGCAGTAGTGGTAGAAAAGCTGTTTTTGTGTATTTCAAATGGTCACGTAGACCATTAACATGCCACCGACCATTAAAACACTTCCGGTTTACATAGTGCCACATCTAATGTACAATTCTACCCATACACATGCATATTCAGTGAATGGGACACCTTGTTGTCACAGAAAACAACCCTGAGTGAAAAAATAACACCAATAAACTGAAAGGTGCCGACAGAACCAAAACCCCGACGCTCCCGTTCGACCTAATCTGGGATCTAATGGAAGATGCTCCATACATTCATTCTCCTTCTACTTCCTCAAACACTTTTCAAGGTTGATCTATTTCAAACCTTTTTCATTTCCCCTGAAACCTTGTTTTATTATTAAAGCCC

Function


NR:

description
PREDICTED: teneurin-2-like isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU111687 True 651 lncRNA 0.45 1 91085890 91086540

Neighbor


gene id symbol gene type direction distance location
LOC110516041 jakmip3 coding downstream 13174 90982735 ~ 91072716 (-)
LOC118936689 dpysl4 coding downstream 115299 90919995 ~ 90970591 (-)
LOC110513773 LOC107083051 coding downstream 271959 90803324 ~ 90813931 (-)
LOC118966739 LOC106577420 coding downstream 337499 90746652 ~ 90748391 (-)
LOC118966738 LOC106594844 coding downstream 339284 90745393 ~ 90746606 (-)
LOC110531579 LOC106577354 coding upstream 3871 91090411 ~ 91119379 (-)
LOC118966091 tcerg1l coding upstream 230628 91317168 ~ 91530447 (-)
LOC110531398 glrx3 coding upstream 707078 91791792 ~ 91832379 (-)
LOC118966740 NA coding upstream 1457349 92543889 ~ 92544887 (-)
LOC118966741 NA coding upstream 1530516 92617056 ~ 92622002 (-)
G100435 NA non-coding downstream 14482 91071168 ~ 91071408 (-)
G100431 NA non-coding downstream 23906 91059315 ~ 91061984 (-)
G100430 NA non-coding downstream 32850 91052704 ~ 91053040 (-)
G100426 NA non-coding downstream 38070 91046968 ~ 91047820 (-)
G100403 NA non-coding downstream 77984 91000409 ~ 91007906 (-)
G100416 NA non-coding upstream 316 91086856 ~ 91087762 (-)
G100441 NA non-coding upstream 1265 91087805 ~ 91088104 (-)
G100442 NA non-coding upstream 2170 91088710 ~ 91089089 (-)
G100443 NA non-coding upstream 7162 91093702 ~ 91094427 (-)
G100445 NA non-coding upstream 14054 91100594 ~ 91101188 (-)
G100197 NA other downstream 226918 90625080 ~ 90858972 (-)
G99602 NA other downstream 1121685 89963873 ~ 89964205 (-)
G99595 NA other downstream 1127974 89957392 ~ 89957916 (-)
G99035 NA other downstream 1795834 89287214 ~ 89290056 (-)
G100582 NA other upstream 146200 91232740 ~ 91233788 (-)
G102060 NA other upstream 1505041 92591581 ~ 92595514 (-)
G102083 NA other upstream 1550758 92637298 ~ 92638881 (-)
G102119 NA other upstream 1652473 92739013 ~ 92739530 (-)

Expression


G100415 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G100415 Expression in each Bioproject

Bar chart with 20 bars.
G100415 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network