G102158


Basic Information

Item Value
gene id G102158
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 92873569 ~ 92874498 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU114032
agggagttgtacctgtctgacatggtggtaatgcctgtactgtggtggacagggagttgtacctgtctgacatggtggtaatgcctgtactgtggtggacagggagttgtacctgtctgacatggtggtaatgcctgtactgtgtactgtggtggacaggaagttgtacctgtctgacatggtggtaatgcctgtactgtggtggacagggagttgtacctgtctgacatggtggtaatgcctgtactgtggtggacagggagttgtacctgtctgacatggtggtaatgcctgtactgtggtggacagggagttgtacctgtctgacatggtggtaatgcctgtactgtggtggacagggagttgtacctgtctgacatggtggtaatgcctgtactgtgtactgtggtggacagggagttgtacctgtctgacatggtggtaatgcctgtactgtgtactgtggtgtacaggaagttgtacctgtctgacatggtggtaatgcctgtactgtgtactgtggtggacaggaagttgtacctgtctgacatggtggtaatgcctgtactgtgtactgtggtggacagggagttgtacctgtctgacatggtggtaatgcctgtactgtgtactgtggtgtacagggagttgtacctgtctgacatggtggtaatgcctgtactgtgtactgtggtggacagggagttgtacctgtctgacatggtggtaatgcctgtactgtgtactgtggtggacagg

Function

NR:

description
PREDICTED: mediator of RNA polymerase II transcription subunit 1-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU114032 True 759 TUCP 0.40 2 92873569 92874498

Neighbor

gene id symbol gene type direction distance location
LOC118966095 NA coding downstream 23109 92849040 ~ 92850460 (-)
LOC118966742 NA coding downstream 24625 92847464 ~ 92848944 (-)
LOC118966741 NA coding downstream 251567 92617056 ~ 92622002 (-)
LOC118966740 NA coding downstream 328682 92543889 ~ 92544887 (-)
LOC110531398 glrx3 coding downstream 1041190 91791792 ~ 91832379 (-)
LOC110511284 LOC106613906 coding upstream 241195 93115693 ~ 93117920 (-)
LOC110513667 LOC106592544 coding upstream 307907 93182405 ~ 93710353 (-)
LOC110515886 bccip coding upstream 1165742 94040240 ~ 94054157 (-)
LOC118966114 LOC106575478 coding upstream 1338036 94212534 ~ 94217907 (-)
LOC110514051 LOC106575477 coding upstream 1353301 94227799 ~ 94232711 (-)
G102143 NA non-coding downstream 53696 92819300 ~ 92819873 (-)
G102138 NA non-coding downstream 73282 92800083 ~ 92800287 (-)
G102133 NA non-coding downstream 84205 92789041 ~ 92789364 (-)
G102132 NA non-coding downstream 84723 92788595 ~ 92788846 (-)
G102126 NA non-coding downstream 104654 92768122 ~ 92768915 (-)
G102161 NA non-coding upstream 10262 92884760 ~ 92885362 (-)
G102167 NA non-coding upstream 40814 92915312 ~ 92915910 (-)
G102172 NA non-coding upstream 56695 92931193 ~ 92931461 (-)
G102174 NA non-coding upstream 66224 92940722 ~ 92941254 (-)
G102178 NA non-coding upstream 74368 92948866 ~ 92949479 (-)
G102119 NA other downstream 134039 92739013 ~ 92739530 (-)
G102083 NA other downstream 234688 92637298 ~ 92638881 (-)
G102060 NA other downstream 278055 92591581 ~ 92595514 (-)
G100582 NA other downstream 1639781 91232740 ~ 91233788 (-)
LOC110528622 LOC106592985 other upstream 21983 92868602 ~ 93019314 (-)
G102217 NA other upstream 177779 93052277 ~ 93052849 (-)
G102290 NA other upstream 427487 93301985 ~ 93339644 (-)
G102641 LOC106593079 other upstream 1148511 94023009 ~ 94023303 (-)

Expression


Co-expression Network