G101885



Basic Information


Item Value
gene id G101885
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 93448836 ~ 93450843 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU113656
atggtgtaggtagactatattacatggatgtattgtgatggtgtagactatattacatggatgtattgtgatggtgtagactatattacatggatgtattgtgatggtgtagactatattacatggatttattgtgatggtgtaggtagactatattacatggatttattgtgatggtgtaggtagactatattacatggatttattgtgatggtgtaggtagaatatattacatggatttattgtgatggtgtaggtagactatattacatggatttattgtgatggtgtagactatattacatggattta

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU113656 True 312 lncRNA 0.32 2 93448836 93450843
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118966102 NA coding upstream 401604 93046026 ~ 93047232 (+)
LOC110533005 clrn3 coding upstream 414369 93027579 ~ 93034467 (+)
LOC118964553 NA coding upstream 1085975 92359998 ~ 92362861 (+)
LOC110522569 LOC106613918 coding upstream 1365852 92012752 ~ 92084472 (+)
LOC110531613 LOC106577355 coding upstream 1564456 91877562 ~ 91884380 (+)
LOC110511695 LOC106577385 coding downstream 271545 93722388 ~ 93770095 (+)
LOC110517068 LOC106577343 coding downstream 330636 93781479 ~ 94002963 (+)
LOC110515218 LOC106591983 coding downstream 559836 94010679 ~ 94040287 (+)
LOC118966112 NA coding downstream 573067 94023910 ~ 94027476 (+)
LOC110515885 hem4 coding downstream 603438 94054281 ~ 94067997 (+)
G101875 NA non-coding upstream 19772 93426945 ~ 93429064 (+)
G101859 NA non-coding upstream 42780 93405592 ~ 93406056 (+)
G101854 NA non-coding upstream 49430 93398788 ~ 93399406 (+)
G101834 NA non-coding upstream 105136 93343312 ~ 93343700 (+)
G101826 NA non-coding upstream 126987 93320934 ~ 93321849 (+)
G101894 NA non-coding downstream 19126 93469969 ~ 93471296 (+)
G101895 NA non-coding downstream 21582 93472425 ~ 93472802 (+)
G101899 NA non-coding downstream 46204 93497047 ~ 93497591 (+)
G101901 NA non-coding downstream 48697 93499540 ~ 93500718 (+)
G101924 NA non-coding downstream 101700 93552543 ~ 93553172 (+)
G101737 NA other upstream 432074 93015922 ~ 93016762 (+)
G101642 LOC106594265 other upstream 576136 92867676 ~ 92872700 (+)
G101557 NA other upstream 917017 92527019 ~ 92531819 (+)
LOC118966092 NA other upstream 1612194 91833232 ~ 91837213 (+)
G100377 NA other upstream 2337974 91109249 ~ 91110862 (+)
G102505 NA other downstream 382281 93833124 ~ 93835192 (+)
G102710 NA other downstream 760206 94211049 ~ 94212908 (+)
G102740 NA other downstream 794654 94245497 ~ 94247931 (+)
G102769 NA other downstream 863850 94314693 ~ 94393315 (+)

Expression


G101885 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G101885 Expression in each Bioproject

Bar chart with 18 bars.
G101885 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network