LOC100301652 (LOC100301652)



Basic Information


Item Value
gene id LOC100301652
gene name LOC100301652
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 24503806 ~ 24504593 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>NM_001160485.1
ATGCTCTACACACACAAGATTAACAGTCTAAACAGTGGGGATGTGTATCTGGTAAATGCCCACTGCGATGTAAAGGAGAAGGACCAGGAGAAGAAGGAGTCCTACCAGGCCACTTGGTTGGACTTGGTGATGGAAACAAGACCAGAACAACAGACCACATTGTTTGAAAACGACTCCTCGAGAAAGGAGACCTACAAGCAGAAACAGGTGGCTCATTTCTTGGTCCAGAGAAACCCCAGTCAGAGGATCAAGATGGGCACAAGGGGTGGAATGCTGAAGGAGTACCAGCTGCCATACAAGAACGCCATCCGTGTGCCCATCTTCACTCCCAGCACAGCCGTCCCACCCAAAGACCTGTACAGATCACCTTCTCCATCAGAGTACAAGTCTATCATGGAATTTGAGACGATCGCCAAAGGAGTATGTTCAGATAAACAGGAGATTTTCGAAATCACTAAGGACTTACCTAAGGTCTCCCAACCTATCCGTGTTAACTTCAGGGCATCTAGTCTTATATCCCCAACACGTGAGTTTTCACACTCCTTCAGGGGTTGA

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description
K19879 TCAP; telethonin

RNA


RNA id representative length rna type GC content exon number start site end site
NM_001160485.1 True 555 mRNA 0.48 2 24503806 24504593
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110538859 LOC106578507 coding downstream 11324 24480265 ~ 24492482 (-)
LOC110538767 LOC106605667 coding downstream 250705 24249862 ~ 24253101 (-)
LOC110538717 LOC106578554 coding downstream 319634 24178523 ~ 24184172 (-)
LOC110538705 LOC106577653 coding downstream 330970 24144519 ~ 24172836 (-)
LOC118938710 LOC106605635 coding downstream 364138 24138846 ~ 24139668 (-)
LOC110538887 LOC106605647 coding upstream 26831 24531424 ~ 24540898 (-)
LOC110538978 LOC106605653 coding upstream 79800 24584393 ~ 24601385 (-)
LOC110538828 grik2 coding upstream 358313 24862906 ~ 25110583 (-)
LOC110533704 cep162 coding upstream 912847 25417440 ~ 25427699 (-)
LOC110539072 cep162 coding upstream 924390 25428983 ~ 25443516 (-)
G125126 NA non-coding downstream 31451 24472013 ~ 24472355 (-)
G125123 NA non-coding downstream 33822 24469753 ~ 24469984 (-)
G125083 NA non-coding downstream 82902 24394855 ~ 24420904 (-)
G125101 NA non-coding downstream 94002 24404413 ~ 24409804 (-)
G125078 NA non-coding downstream 120895 24381406 ~ 24382911 (-)
G125192 LOC106605651 non-coding upstream 65320 24569913 ~ 24570690 (-)
G125220 NA non-coding upstream 117810 24622403 ~ 24622633 (-)
G125230 NA non-coding upstream 129173 24633766 ~ 24685283 (-)
G125244 NA non-coding upstream 143970 24648563 ~ 24650144 (-)
G125273 NA non-coding upstream 202881 24707474 ~ 24707709 (-)
G125043 NA other downstream 178970 24324580 ~ 24324836 (-)
G125003 NA other downstream 233670 24269226 ~ 24270136 (-)
G124840 NA other downstream 599129 23903839 ~ 23904677 (-)
LOC110538355 LOC106577931 other downstream 1222008 23279116 ~ 23281851 (-)
G125305 NA other upstream 270627 24775220 ~ 24776627 (-)
G127083 NA other upstream 2057021 26561614 ~ 26562127 (-)
LOC110539285 LOC106579350 other upstream 2146783 26641958 ~ 26675649 (-)
LOC110485245 ubr5 other upstream 2766667 27231538 ~ 27278158 (-)

Expression


LOC100301652(LOC100301652) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1000.
End of interactive chart.

LOC100301652(LOC100301652) Expression in each Bioproject

Bar chart with 8 bars.
LOC100301652(LOC100301652) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network