LOC110534576 (dpys)


Basic Information

Item Value
gene id LOC110534576
gene name dpys
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 27907789 ~ 27909986 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>LOC110534576
ATGTCTGACAGTAACATATCACACGGGGCTAAGAAGATGCTGTCCCTGGGCATCACAGGTCCGGAGGGTCATGAGTTGTGTCGTCCTGAGGAGCCGTCACCATCGCACACGCTGTCAACTGCCCGCTTTATGTGGTCCACGTCATGCGCAAGTCTGCCGCTAAGGTGGTGTCCAACGCACGCAGGAATGGCCGTGCGGTGTTTGGAGAGCCCATAGCATCATGACTGGGTACAGATGGCACCCACTGCTGGCACAAAGACTGGGCCCACGCTGCCAAGTTCGTCATGGGCCCACCTCTGAGGCCTGACCCCAGCACCACGGGACACCTTATGGACCTACTGGCAAATGATGACCTCAGTGTGACTGGGACAGACAACTGCACATTCTCTGTGTGTCAGAAGGCCCTGGGCAAAGAGGACAGGATGTCTGTCAGTTGGGAGAAGGGCGTTGTCAGTTAG

Function

symbol description
dpys Predicted to enable dihydropyrimidinase activity. Predicted to be involved in pyrimidine nucleobase catabolic process. Predicted to be located in cytoplasm. Human ortholog(s) of this gene implicated in dihydropyrimidinase deficiency and purine-pyrimidine metabolic disorder. Orthologous to human DPYS (dihydropyrimidinase).

NR:

description
dihydropyrimidinase

GO:

id name namespace
GO:0006208 pyrimidine nucleobase catabolic process biological_process
GO:0005737 cytoplasm cellular_component
GO:0016812 hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
LOC110534576 True 458 mRNA 0.57 4 27907789 27909986

Neighbor

gene id symbol gene type direction distance location
LOC110485628 LOC106605483 coding upstream 229775 27651611 ~ 27678014 (+)
LOC110485563 LOC106579093 coding upstream 488624 27409765 ~ 27419165 (+)
LOC110485528 LOC106605545 coding upstream 498800 27403665 ~ 27408989 (+)
LOC110485543 LOC106579099 coding upstream 504364 27390590 ~ 27403425 (+)
LOC110485507 LOC106579115 coding upstream 527380 27331697 ~ 27380409 (+)
LOC110485682 LOC106605395 coding downstream 255174 28165160 ~ 28171323 (+)
LOC110485672 LOC106605394 coding downstream 261860 28171846 ~ 28180205 (+)
ddr1 LOC106605397 coding downstream 284576 28194562 ~ 28250766 (+)
LOC110485735 LOC106605407 coding downstream 360265 28270251 ~ 28280280 (+)
LOC110485723 LOC106605400 coding downstream 371126 28281112 ~ 28296740 (+)
G128308 NA non-coding upstream 2063 27903975 ~ 27905726 (+)
G128238 NA non-coding upstream 83887 27795883 ~ 27823902 (+)
G128233 NA non-coding upstream 120434 27786784 ~ 27787355 (+)
G128231 NA non-coding upstream 123218 27784299 ~ 27784571 (+)
G128225 NA non-coding upstream 133249 27774338 ~ 27774540 (+)
G128319 NA non-coding downstream 8444 27918430 ~ 27918637 (+)
G128322 NA non-coding downstream 13169 27923155 ~ 27923430 (+)
G128324 NA non-coding downstream 17285 27927271 ~ 27927495 (+)
G128368 NA non-coding downstream 81317 27991303 ~ 28022887 (+)
G128376 NA non-coding downstream 94877 28004863 ~ 28005343 (+)
G128185 NA other upstream 190626 27716482 ~ 27717163 (+)
LOC110485466 LOC106605529 other upstream 604234 27288172 ~ 27303644 (+)
G127644 LOC106605534 other upstream 717196 27189991 ~ 27190593 (+)
LOC110485212 LOC106605536 other upstream 747144 27147880 ~ 27175747 (+)
G127198 LOC106605538 other upstream 1046547 26857698 ~ 26861242 (+)
G128436 NA other downstream 178661 28088647 ~ 28089445 (+)
G128490 NA other downstream 340856 28250842 ~ 28547915 (+)
LOC110485990 LOC106579931 other downstream 1022070 28931988 ~ 28951235 (+)
G128853 LOC106605419 other downstream 1029913 28939899 ~ 28981288 (+)
LOC110534631 LOC106580029 other downstream 1567631 29424822 ~ 29478401 (+)

Expression


Co-expression Network