trnas-gcu



Basic Information


Item Value
gene id trnas-gcu
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 48810352 ~ 48810433 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnas-gcu
gatgaggtggccgagtggttaaggcgatggactgctgatccattgtgctctgcatgcatgggttcgaatcccatccttatcg

Function


NR:

description
dipeptidyl peptidase 3 isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnas-gcu True 82 mRNA 0.51 1 48810352 48810433
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118940428 NA coding downstream 99122 48701449 ~ 48711230 (-)
ptdss2 ptdss2 coding downstream 112358 48661451 ~ 48697994 (-)
th th coding downstream 249520 48537830 ~ 48560832 (-)
commd9 commd9 coding downstream 353094 48449143 ~ 48457258 (-)
nap1l4a LOC106560703 coding downstream 425540 48319220 ~ 48384812 (-)
trnas-gcu-2 NA coding upstream 1038 48809911 ~ 48812873 (-)
trnas-gcu-3 NA coding upstream 2156 48812589 ~ 48812670 (-)
ifitm5 LOC106560727 coding upstream 265660 49076093 ~ 49078840 (-)
cat cata coding upstream 292553 49102986 ~ 49114529 (-)
syt12 syt12 coding upstream 304309 49114742 ~ 49155261 (-)
G152618 NA non-coding downstream 4149 48805952 ~ 48806203 (-)
G152605 NA non-coding downstream 12544 48797541 ~ 48797808 (-)
G152596 NA non-coding downstream 16148 48793939 ~ 48794204 (-)
G152594 NA non-coding downstream 18271 48791752 ~ 48792081 (-)
G152542 NA non-coding downstream 51347 48758783 ~ 48759005 (-)
G152833 NA non-coding upstream 168958 48979391 ~ 48979626 (-)
G152895 NA non-coding upstream 232593 49043026 ~ 49043255 (-)
G153535 NA non-coding upstream 401169 49211602 ~ 49211822 (-)
G153538 NA non-coding upstream 408874 49219307 ~ 49219528 (-)
peak1 peak1 non-coding upstream 527251 49166669 ~ 49427283 (-)
G152024 NA other downstream 506689 48303311 ~ 48303663 (-)
G151920 NA other downstream 583408 48226299 ~ 48226944 (-)
G151875 NA other downstream 622074 48187958 ~ 48188278 (-)
G151474 NA other downstream 959004 47850785 ~ 47851348 (-)
G150675 LOC100653436 other downstream 1604919 47194893 ~ 47205433 (-)
G154300 NA other upstream 1290997 50101430 ~ 50107447 (-)
G154338 NA other upstream 1346253 50156686 ~ 50157825 (-)
G155003 NA other upstream 1605310 50415743 ~ 50452147 (-)
G155072 NA other upstream 1769365 50579798 ~ 50581349 (-)
G155281 LOC106560681 other upstream 2160643 50971076 ~ 50971935 (-)

Expression


trnas-gcu Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network