rpl27a (rpl27a)



Basic Information


Item Value
gene id rpl27a
gene name rpl27a
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 57326328 ~ 57329184 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XM_021566755.2
GTTTCCATGAAAGTTGTCGGGCAGTAAATCTCGTACAAAACCGTGAGATTTCAGATTCGCGTTCCTCTTTCAACTCTCCTCCAAGATGCCTACCAAGAAGACCAAGACCAGGAAGCTCCGTGGGCACGTCAGCCACGGACATGGTCGTATCGGCAAGCACAGGAAGCATCCTGGAGGTCGTGGTAACGCCGGTGGCATGCATCACCACAGAATTAACTTCGACAAATACCACCCTGGGTACTTTGGTAAGGTGGGCATGAGACACTACCATCTCAAGAGGAACACCGTGCACTGCCCCACTGTCAACCTGGACAAACTGTGGACACTCGTGAGCGAGCAGACCAGGCTCAACTACGCCAAGAAGCCCGAAGGCCCTGCGCCCATCATTGATGCCGTGCGCGCTGGCTACTTCAAAGTGCTGGGCAAAGGCAAACTGCCCAAGCAGCCTGTGATCGTCAAGGCAAAGTTCTTCAGTCGACGGGCAGAGGAGAAGATCAAGGCAGTGGGAGGAGCCTGCGTGCTGATGGCATAAGCTCCTGTCAATGTTTTTTGCAAGAATAAACTGTATAAATTGGA

Function


symbol description
rpl27a Predicted to be a structural constituent of ribosome. Predicted to act upstream of or within translation. Predicted to be located in ribosome. Predicted to be part of large ribosomal subunit. Orthologous to human RPL27A (ribosomal protein L27a).

NR:

description
unnamed protein product

GO:

id name namespace
GO:0006412 translation biological_process
GO:0005840 ribosome cellular_component
GO:0003735 structural constituent of ribosome molecular_function

KEGG:

id description
K02900 RP-L27Ae, RPL27A; large subunit ribosomal protein L27Ae

RNA


RNA id representative length rna type GC content exon number start site end site
XM_021566755.2 True 576 mRNA 0.53 5 57326328 57329184

Neighbor


gene id symbol gene type direction distance location
LOC110492362 LOC106561070 coding upstream 23446 57289492 ~ 57302882 (+)
LOC110492317 LOC106561060 coding upstream 298550 56869081 ~ 57027778 (+)
LOC110492194 LOC106561057 coding upstream 491142 56679708 ~ 56835186 (+)
LOC110492444 LOC106561059 coding upstream 671463 56649543 ~ 56654865 (+)
LOC110492175 LOC106561078 coding upstream 688692 56633497 ~ 56637636 (+)
akip1 bca3 coding downstream 1212 57330396 ~ 57331987 (+)
LOC110492278 wee1 coding downstream 17676 57346860 ~ 57368863 (+)
swap70b LOC106561063 coding downstream 42392 57371576 ~ 57398186 (+)
LOC110492386 LOC106561075 coding downstream 101003 57430187 ~ 57432107 (+)
LOC110492347 LOC106561068 coding downstream 111459 57440643 ~ 57449264 (+)
G162944 NA non-coding upstream 7648 57318470 ~ 57318680 (+)
G162939 NA non-coding upstream 15497 57310584 ~ 57310831 (+)
G162922 NA non-coding upstream 48313 57277803 ~ 57278015 (+)
G162270 NA non-coding upstream 161492 57074503 ~ 57164836 (+)
G162299 NA non-coding upstream 200884 57125145 ~ 57125444 (+)
G162955 NA non-coding downstream 17054 57346238 ~ 57346489 (+)
G163047 NA non-coding downstream 201766 57530950 ~ 57531175 (+)
G163048 NA non-coding downstream 202765 57531949 ~ 57532168 (+)
G163049 NA non-coding downstream 204764 57533948 ~ 57534243 (+)
LOC110492340 LOC106561069 non-coding downstream 207768 57536947 ~ 57546176 (+)
G162130 NA other upstream 272686 57048314 ~ 57053642 (+)
G161687 NA other upstream 1073730 56245044 ~ 56252598 (+)
G160569 NA other upstream 1379083 55946143 ~ 55947245 (+)
G159889 LOC106562215 other upstream 2597468 54728296 ~ 54728860 (+)
G159415 NA other upstream 2972940 54352983 ~ 54353388 (+)
G163513 LOC106561046 other downstream 598966 57928150 ~ 57931991 (+)
G163660 LOC106561040 other downstream 886493 58215677 ~ 58216383 (+)
G166131 lmod2 other downstream 2616524 59945708 ~ 59953165 (+)
G166878 NA other downstream 3186448 60515632 ~ 60515880 (+)
LOC110493059 LOC100194658 other downstream 3522248 60851417 ~ 60866455 (+)

Expression


rpl27a(rpl27a) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1500.
End of interactive chart.

rpl27a(rpl27a) Expression in each Bioproject

Bar chart with 21 bars.
rpl27a(rpl27a) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60000.
End of interactive chart.

Co-expression Network