trnal-cag



Basic Information


Item Value
gene id trnal-cag
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 69134783 ~ 69134865 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnal-cag
gtcaggatggccgagcggtctaaggcgctgcgttcaggtcgcagtctcccctggaggcgtgggttcgaatcccacttctgaca

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnal-cag True 83 mRNA 0.60 1 69134783 69134865
Loading

Neighbor


gene id symbol gene type direction distance location
exosc6 exosc6 coding upstream 20978 69112063 ~ 69113805 (+)
st3gal2 st3gal2 coding upstream 41708 69069631 ~ 69093075 (+)
LOC118941448 LOC107672167 coding upstream 166226 68963784 ~ 68968557 (+)
siah1 siah1 coding upstream 187677 68920701 ~ 68947106 (+)
LOC110494586 n4bp1 coding upstream 225311 68883169 ~ 68909472 (+)
psme3ip1 LOC106560853 coding downstream 31930 69166795 ~ 69176697 (+)
LOC110494820 NA coding downstream 180703 69315568 ~ 69325990 (+)
b3gnt9 LOC106560847 coding downstream 191242 69326107 ~ 69332525 (+)
LOC110494892 LOC106560841 coding downstream 463732 69598438 ~ 69608770 (+)
LOC110494936 LOC106560837 coding downstream 692645 69827510 ~ 69834723 (+)
G176863 LOC106560856 non-coding upstream 7949 69126180 ~ 69126834 (+)
G176861 NA non-coding upstream 9118 69124935 ~ 69125665 (+)
G176859 LOC106560856 non-coding upstream 12053 69121532 ~ 69122730 (+)
G176858 LOC106560856 non-coding upstream 13444 69121044 ~ 69121339 (+)
G176857 NA non-coding upstream 13829 69120668 ~ 69120954 (+)
G176888 NA non-coding downstream 30143 69165008 ~ 69165317 (+)
G176889 NA non-coding downstream 30830 69165695 ~ 69165960 (+)
G176970 NA non-coding downstream 175664 69310529 ~ 69311710 (+)
G176987 NA non-coding downstream 210339 69345204 ~ 69346102 (+)
G176725 lonp2 other upstream 176897 68956263 ~ 68957886 (+)
G176612 LOC100846954 other upstream 273415 68860838 ~ 68861368 (+)
hsbp1b LOC106561110 other upstream 1646582 67486128 ~ 67488205 (+)
LOC110494472 utp4 other upstream 1894887 67232278 ~ 67239902 (+)
LOC110494451 zfpm1 other upstream 2162328 66900017 ~ 66995521 (+)
G177067 NA other downstream 321693 69456558 ~ 69457433 (+)
G177812 NA other downstream 972421 70107286 ~ 70113440 (+)
igf1ra igf1r other downstream 1660545 70794530 ~ 70905277 (+)
LOC110495604 LOC106573778 other downstream 2924852 72059717 ~ 72065199 (+)
LOC110533853 LOC106561194 other downstream 3118573 72250884 ~ 72253809 (+)

Expression


trnal-cag Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

trnal-cag Expression in each Bioproject

Bar chart with 4 bars.
trnal-cag Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network