trnah-gug-2



Basic Information


Item Value
gene id trnah-gug-2
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 73455432 ~ 73455503 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnah-gug-2
gccgtgatcgtatagtggttagtactctgcgttgtggccgcagcaaccccggttcgaatccgggtcacggca

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnah-gug-2 True 72 mRNA 0.56 1 73455432 73455503

Neighbor


gene id symbol gene type direction distance location
malt3 LOC106561168 coding upstream 570 73436134 ~ 73454862 (+)
slc28a1 LOC106561167 coding upstream 36594 73409052 ~ 73418838 (+)
LOC110495840 LOC106561167 coding upstream 49645 73400259 ~ 73405787 (+)
LOC110495809 LOC106561197 coding upstream 92902 73361309 ~ 73362530 (+)
si:dkey-24l11.2 LOC106561161 coding upstream 94263 73351800 ~ 73361169 (+)
LOC110501876 LOC106561170 coding downstream 1166 73456669 ~ 73580075 (+)
LOC110495913 ankrd34c coding downstream 277892 73733395 ~ 73737729 (+)
idh2 LOC100194640 coding downstream 301469 73756972 ~ 73768531 (+)
LOC110495946 LOC106561177 coding downstream 428048 73883551 ~ 73984737 (+)
LOC110495967 LOC106573468 coding downstream 543766 73999269 ~ 74010559 (+)
G182020 NA non-coding upstream 40711 73413662 ~ 73414721 (+)
G181965 NA non-coding upstream 88449 73365579 ~ 73366983 (+)
G181994 NA non-coding upstream 115360 73339463 ~ 73340072 (+)
G181989 LOC107750509 non-coding upstream 126571 73327462 ~ 73328861 (+)
G181948 NA non-coding upstream 158749 73269027 ~ 73296683 (+)
G182124 NA non-coding downstream 118102 73573605 ~ 73573921 (+)
G182037 NA non-coding downstream 131601 73587104 ~ 73587665 (+)
G182154 LOC108230026 non-coding downstream 180124 73635627 ~ 73636093 (+)
G182155 LOC106573487 non-coding downstream 181047 73636550 ~ 73636988 (+)
G182209 NA non-coding downstream 250829 73706332 ~ 73766435 (+)
G181995 NA other upstream 113155 73341380 ~ 73342277 (+)
LOC110533853 LOC106561194 other upstream 1201705 72250884 ~ 72253809 (+)
LOC110495604 LOC106573778 other upstream 1390237 72059717 ~ 72065199 (+)
igf1ra igf1r other upstream 2647528 70794530 ~ 70905277 (+)
G177812 NA other upstream 3341992 70107286 ~ 70113440 (+)
G182139 LOC106561173 other downstream 151389 73606892 ~ 73610237 (+)
G182144 NA other downstream 167033 73622536 ~ 73624518 (+)
G183361 NA other downstream 1074146 74529649 ~ 74535026 (+)
LOC110496107 LOC106561202 other downstream 1256078 74660359 ~ 74732682 (+)

Expression


trnah-gug-2 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network