LOC118936851



Basic Information


Item Value
gene id LOC118936851
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 85697420 ~ 85699798 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XM_036934325.1
ATGTCCAGCACTATCCACCACTGCCCACCACCATCCACCACTATCCACCACTGCCCACCACCATCCACCACTATCCAGCACTATCCACGACTGCCCAGCACTATCCAGCACTGTCTGCCACTATCCACTACTGTCTGCCACTATCCAGCACTGTCTGCCACTATCCAGCGCTATCCACCACTGCCCAGCGCTATCCACCACTGCCCAGCACTATCCACCACTGCCCAGCGCTATCCACCACTGCCCAGCGCTATCCACCACTGCCCAGCGCTATCCACCACTGCCCAGCGCTATACACCACTGCCCAGCGCTATACACCACTGCCCAGCGCTATCCACCACTGCCCAACGCTATCCACCACTGCCCAGCGCTATCCACCACTGCCCAGCGCTGTGCACCCCTGCCCAGCGCTATCCACCACTGCCCAGCGCTATCCACCACTGCCCAACGCTATCCACCACTGCCCAGCGCTATACACCACTGCCCAGCGCTATCCACCACTGCCCAGCGCTATCCACCACTGCCCAACGCTATCCACCACTGCCCAGCGCTATCCACCACTGCCCAGCGCTGTGCACCCCTGCCCAGCGCTGTCCACCACTGCCCAGCGCTTTCCACCACTGCCCAGCGCTATCCAGCATTATCCACCACTGCCAAACACAATCCACCACTGCCCACCACTATCCACCACTGCCCACCACTATCCAGCATTATCCACCACTGCCAAACACAATCCACCACTGCCCACCACTATCCACCACTGCCCACCACTATCCAGCATTATCCACCACTGCCCAGCGCTATCCACCACTGCCCAGCGCTATCCACCACTGCCCAGCGCTATACACCACTGCCCAGCGCTATACACCACTGCCCAGCGCTATCCACCACTGCCCAACGCTATCCACCACTGCCCAGCGCTATCCACCACTGCCCAGCGCTGTGCACCCCTGCCCAGCGCTATCCACCACTGCCCAGCGCTATCCACCACTGCCCAACGCTATCCACCACTGCCCAGCGCTATACACCACTGCCCAGCGCTATCCACCACTGCCCAGCGCTGTCCACCACTGCCCAACGCTATCCACCACTGCCCAGCGCTATCCACCACTGCCCAGCGCTATCCACCACTGCCCAACGCTATCCACCACTGCCCAACGCTATCCACCACTGCCCAGCGCTATCCACCACTGCCCAGCGCTGTGCACCCCTGCCCAGCGCTGTCCACCACTGCCCAGCGCTTTCCACCACTGCCCAGCGCTATCCAGCATTATCCACCACTGCCAAACACAATCCACCACTGCCCACCACTGCCCACCACTGTCCACCACTGCCCACCACTATCCAGCATTATCCACCACTGCCAAACACAATCCACCACTGCCCACCACTATCCACCACTGCCCACCACTATCCAGCATTATCCACCACTGCCAAACACAATCAACCACTGCCCAACACAATCCACCACTGCCCAACACAATCCACGACTGCCCACCACTATCCACGACTGCCCATCACTATCCACGACTGCCCACCACTATCCACGACTGCCCACCACTATCCACGACTGCCCACCACTATCCACCGCTATCCACGACTGCCCACCGCTATCCACCACTGCCCAACACAATCCACCACTGCCCACCACTATCCACCACTGCCCACCACTATCCAGCATTATCCACCACTGCCCAACACAATCCACCACTGCCCAACACAATCCACCACTGCCCAACACAATCCACCACTGCCCACCACTATCCACGACTGCCCACCACTATCCACGACTGCCCACCACTATCCACGACTGCCCACCACTATCCACGACTGCCCACCACTATCCATGACTGCCCACCACTATCCACCACTGCCCACCACTATCCACCACTGCCCACCACTATCCACGACTGCCCACCACTGCCCACCACTATCCACCACTATCCACGACTTCCCACAGCTATCCACGACTGCTCACCACTATCCACGACTGCCCACCACTATCCACGACTGCCCACCACTATCCACGACTGCCCACCACTATCCACCGCTATCCACCATTGCCCACCGCTATCCACGACTGCCCACCGCTATCCACGACTGCCCACCACTATCCACGACTTCCCACCACTATCCACGACTGCCTACCACTATCCACAACTGCCCACAGCTATCCACGACTGCCCACCACTATCCACCATTTCCCACCACTATCCACGACTGCCCACCACTGTCCACGACTGCCCATCACTATCCACGACTGCCCACCACTATCCACGACTGCCCACCACTATCCACCACTGCCCACCACTATCCACCACTATCCACCACTGCCCACCACTATCCATGACGGCCACCACTGTCCAGCACTATCCATGA

Function


NR:

description
PREDICTED: uncharacterized protein LOC107395943

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XM_036934325.1 True 2379 mRNA 0.60 1 85697420 85699798
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110498116 LOC106561379 coding downstream 151948 85538383 ~ 85545472 (-)
LOC110502232 LOC106561380 coding downstream 209624 85470939 ~ 85487796 (-)
LOC110498041 LOC106561383 coding downstream 594635 85058747 ~ 85102785 (-)
LOC110498022 LOC106561385 coding downstream 786542 84596433 ~ 84910878 (-)
LOC110502226 LOC106573176 coding downstream 1112013 84556466 ~ 84585407 (-)
LOC110502240 nup205 coding upstream 11741 85711539 ~ 85726478 (-)
dennd11 kiaa1147 coding upstream 34461 85734259 ~ 85748399 (-)
bcl2l13 LOC106561371 coding upstream 66290 85766088 ~ 85802952 (-)
LOC110502245 NA coding upstream 103880 85803678 ~ 85804353 (-)
LOC118936424 slc25a18 coding upstream 136162 85835960 ~ 85838800 (-)
G197394 NA non-coding downstream 12894 85640538 ~ 85684526 (-)
G197328 NA non-coding downstream 213795 85483027 ~ 85483625 (-)
G196784 NA non-coding downstream 245337 85451850 ~ 85452083 (-)
G196757 NA non-coding downstream 263265 85431738 ~ 85434155 (-)
G196750 NA non-coding downstream 268772 85428237 ~ 85428648 (-)
G197441 NA non-coding upstream 52643 85752441 ~ 85754218 (-)
G197498 slc25a18 non-coding upstream 131441 85831239 ~ 85843493 (-)
G197552 LOC106561360 non-coding upstream 327092 86026890 ~ 86043305 (-)
G197613 NA non-coding upstream 374475 86074273 ~ 86074839 (-)
G197636 LOC106561359 non-coding upstream 409265 86109063 ~ 86109468 (-)
G195486 LOC106573171 other downstream 1715253 83977965 ~ 83982167 (-)
G195427 NA other downstream 1792969 83881540 ~ 83904451 (-)
G194491 NA other downstream 2081386 83615566 ~ 83616034 (-)
LOC110502187 NA other downstream 2474276 83219964 ~ 83223972 (-)
G197554 NA other upstream 260047 85959845 ~ 85963665 (-)
G198342 LOC100194703 other upstream 1203238 86903036 ~ 86903956 (-)
G198912 NA other upstream 1622341 87322139 ~ 87326469 (-)
LOC110499346 vps4a other upstream 3907039 89606837 ~ 89609890 (-)

Expression


LOC118936851 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.2.
End of interactive chart.

LOC118936851 Expression in each Bioproject

Bar chart with 14 bars.
LOC118936851 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 5.
End of interactive chart.

Co-expression Network