XLOC_020746 (tbxa2r)



Basic Information


Item Value
gene id XLOC_020746
gene name tbxa2r
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information


Item Value
chromosome id NC_007133.7
NCBI id CM002906.2
chromosome length 39133080
location 3336723 ~ 3344613 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence


>TCONS_00040920
ATCGCCCACCCTTACCTCCAGGTTCCCGGTTCCTGGTGCTTCCTCAACATCAGCTCTGCTCCTCTGGATATGACGTTCGGTCTGATCTTCTCGCTGGTGGGTTTGGCGTCTCTGGCCGTGTCGTTCCTGCTGAACACTGTGAGCGTGGTCACATTATTACGGGTGTGTTGTGGAGCCGACAGCACTCAGAGGAGGCGCGACTACGAGGTGGAGATGATGGTGCAGCTCATCTTGATCATGGTGATCGCCTCCATCTGCTGGTGCCCTCTGCTGGTGTTTATAGCGCAGACCGTGCTGTCAGGAAGTGAGCTCGATGTTCGATACCTGCTGCTCTGGCTGCGCTTTGCGACAGGAAATCAAGTCCTGGATCCCTGGGTTTACATCCTGTTCCGACGTGCCATACTGAAGCGAGTCGCTCCCAAAATGGATTGGTCCCGCGGATCCATCGTCAGCCTTTACCCAACGCTCTCTACGTCATTTCGCAAACTAACTCGAGCCTCTCTTGGGGGAACGCTTGACCGTCTGGATCACATTCGGCCAAATCAATGCATTGTCAGACAAGAGGATACACCTTTACCTGTGCTGGACACCTCTGCAACTTCCGTTTAG

Function


symbol description
tbxa2r Enables thromboxane A2 receptor activity. Predicted to act upstream of or within G protein-coupled receptor signaling pathway. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Is expressed in gill; muscle; and pleuroperitoneal region. Human ortholog(s) of this gene implicated in aspirin-induced respiratory disease; asthma; and blood platelet disease. Orthologous to human TBXA2R (thromboxane A2 receptor).

GO:

id name namespace
GO:0007186 G protein-coupled receptor signaling pathway biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0004930 G protein-coupled receptor activity molecular_function
GO:0004960 thromboxane receptor activity molecular_function
GO:0004961 thromboxane A2 receptor activity molecular_function

KEGG:

id description
ko04020 Calcium signaling pathway
ko04080 Neuroactive ligand-receptor interaction
ko04611 Platelet activation
ko04030 G protein-coupled receptors

ZFIN:

id description
ZDB-GENE-131016-6 Enables thromboxane A2 receptor activity. Predicted to act upstream of or within G protein-coupled receptor signaling pathway. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Is expressed in gill; muscle; and pleuroperitoneal region. Human ortholog(s) of this gene implicated in aspirin-induced respiratory disease; asthma; and blood platelet disease. Orthologous to human TBXA2R (thromboxane A2 receptor).

Ensembl:

ensembl_id ENSDARG00000104717

RNA


RNA id representative length rna type GC content exon number start site end site
TCONS_00040920 True 609 mRNA 0.55 2 3336723 3344613

Neighbor


gene id symbol gene type direction distance location
XLOC_020745 si:zfos-943e10.1 coding downstream 37368 3262413 ~ 3299355 (-)
XLOC_020744 gpr35.1 coding downstream 74844 3252936 ~ 3261879 (-)
XLOC_020743 lonp1 coding downstream 153758 3160447 ~ 3182965 (-)
XLOC_020742 lmnb2 coding downstream 184366 3121086 ~ 3152357 (-)
XLOC_020741 ing5a coding downstream 244587 2949111 ~ 3092136 (-)
XLOC_020747 NA coding upstream 2900 3347513 ~ 3347884 (-)
XLOC_020748 ptprsa coding upstream 44734 3389347 ~ 3680725 (-)
XLOC_020749 NA coding upstream 395973 3740586 ~ 3741284 (-)
XLOC_020750 NA coding upstream 538994 3883607 ~ 3886684 (-)
XLOC_020751 mhc1uma coding upstream 565997 3910610 ~ 3914222 (-)
XLOC_020738 NA non-coding downstream 444177 2889663 ~ 2892546 (-)
XLOC_020736 NA non-coding downstream 508637 2814463 ~ 2828086 (-)
XLOC_020734 NA non-coding downstream 511022 2795028 ~ 2825701 (-)
XLOC_020735 NA non-coding downstream 529696 2799465 ~ 2807027 (-)
XLOC_020733 NA non-coding downstream 547185 2769742 ~ 2789538 (-)
XLOC_020752 CU074310.1 non-coding upstream 967190 4311803 ~ 4313118 (-)
XLOC_020756 NA non-coding upstream 1388394 4733007 ~ 4735337 (-)

Expression



Co-expression Network


Homologous


species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000031_00452467_00455338 TBXA2R coding CI01000031 null 452467 ~ 456187 (+)