G103826



Basic Information


Item Value
gene id G103826
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 120332 ~ 120836 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU116470
cttagaccagggccctattccctatatagtgcactactttagaccagggccctattccctacatagtgcactacttagaccaggaccctattccctatatagtatactactttagaccagggccctattccctatatagtatactactttagaccagggccctattccctatatagtacactactttagaccagggccctattccctatatag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU116470 True 213 lncRNA 0.40 2 120332 120836
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118936272 LOC106596174 coding upstream 102236 13864 ~ 18096 (+)
LOC110512917 csmd3 coding downstream 28346 149182 ~ 672194 (+)
zgc:110410 LOC106594189 coding downstream 593894 714730 ~ 722393 (+)
LOC118937316 LOC106573240 coding downstream 603955 724791 ~ 731551 (+)
cmc1 cc068 coding downstream 739623 860459 ~ 872515 (+)
LOC110506977 LOC106595099 coding downstream 784740 905576 ~ 908576 (+)
G103790 NA non-coding upstream 65109 54529 ~ 55223 (+)
G103786 NA non-coding upstream 70717 49272 ~ 49615 (+)
G103778 NA non-coding upstream 87740 31897 ~ 32592 (+)
G103774 NA non-coding upstream 90294 25704 ~ 30038 (+)
G103772 NA non-coding upstream 99467 20661 ~ 20865 (+)
G103827 NA non-coding downstream 403 121239 ~ 123282 (+)
G103798 NA non-coding downstream 48997 169833 ~ 181660 (+)
G103853 NA non-coding downstream 63038 183874 ~ 184430 (+)
G103862 NA non-coding downstream 79904 200740 ~ 202233 (+)
G103864 NA non-coding downstream 83193 204029 ~ 204844 (+)
G103851 NA other downstream 54160 174996 ~ 181022 (+)
G104092 NA other downstream 569210 690046 ~ 701271 (+)
G104761 NA other downstream 1032225 1153061 ~ 1153749 (+)
tgfbr2b LOC106606173 other downstream 1188442 1309202 ~ 1390936 (+)

Expression


G103826 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G103826 Expression in each Bioproject

Bar chart with 16 bars.
G103826 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network