G104689



Basic Information


Item Value
gene id G104689
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 1006252 ~ 1006927 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU117742
atagggaatagggaaacaactatatagggaatagggagccaactctatagggaatagagagccaactctatagggaatagggaaacaactatatagggaatagggagccaactctatagggaatagagagccaactctatagggaatagggagccaactctatagggaatagggagccaactctatagggaataggaagccaactctatagggaatagggagccaactctatagggaat

Function


NR:

description
PREDICTED: deleted in azoospermia protein 3-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU117742 True 239 lncRNA 0.41 2 1006252 1006927
Loading

Neighbor


gene id symbol gene type direction distance location
azi2 azi2 coding downstream 100834 879818 ~ 905418 (-)
eomesb eomesb coding downstream 193062 806150 ~ 813190 (-)
LOC110516483 LOC106573240 coding downstream 215381 727654 ~ 790871 (-)
LOC118937315 NA coding downstream 329740 672497 ~ 676512 (-)
LOC118937314 NA coding downstream 498183 423319 ~ 508560 (-)
LOC118937319 NA coding upstream 308737 1314565 ~ 1316245 (-)
LOC110515934 gadl1 coding upstream 420324 1427251 ~ 1457133 (-)
LOC110515405 LOC106590999 coding upstream 566475 1573402 ~ 1683489 (-)
kiaa1143 k1143 coding upstream 696024 1702951 ~ 1704863 (-)
zdhhc3a zdhhc3 coding upstream 702589 1709516 ~ 1732333 (-)
G104672 NA non-coding downstream 30379 972635 ~ 975873 (-)
G104666 LOC100194703 non-coding downstream 38530 967407 ~ 967722 (-)
G104662 NA non-coding downstream 41193 962906 ~ 965059 (-)
G104655 NA non-coding downstream 52368 953674 ~ 953884 (-)
G104644 NA non-coding downstream 67348 938002 ~ 938904 (-)
G104691 NA non-coding upstream 1954 1008881 ~ 1009116 (-)
G104693 NA non-coding upstream 3251 1010178 ~ 1011679 (-)
G104694 NA non-coding upstream 3406 1010333 ~ 1010834 (-)
G104699 NA non-coding upstream 9493 1016420 ~ 1016766 (-)
G104807 NA non-coding upstream 23971 1030898 ~ 1034080 (-)
G105220 NA other upstream 327059 1333986 ~ 1342335 (-)
G105285 NA other upstream 533803 1540730 ~ 1541706 (-)
G105340 NA other upstream 634340 1641267 ~ 1641732 (-)
G105427 NA other upstream 905665 1912592 ~ 1917188 (-)

Expression


G104689 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G104689 Expression in each Bioproject

Bar chart with 5 bars.
G104689 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network