G104825



Basic Information


Item Value
gene id G104825
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 1070316 ~ 1070930 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU117946
ACTCTATAAAGTGGTATCTCAACAGAGAGCGCAAAGTAACCAAAGTCCTTGTTTCAGTCAGACCAGATAACCAGATCTAACAGCAGAATCAGGGTTCAAACTGTCAGTCTTCAGTCAGACCAGATAACCAGATCTAACAGCAGAATCAGGGATCAAACTGTCAGTCTTCAGTCAGACCAGATAACCAGATCTAACAGCAGAATCAGGGTTCAAACTGTCAGTCTTCAGTCAGACCAGATAACCAGATCTAACAGCAGAATCAGGGTTCAAACTGTCAGTCTTCAGTCAGACCAGATAACCAGATCTAACAGCAGAATCAGGGATCAAACTGTCAGTCTTCAGTCAGACCAGATAACCAGATCTAA
>TU117947
ACTCTATAAAGTGGTATCTCAACAGAGAGCGCAAAGTAACCAAAGTCCTTGTTTCAGTCAGACCAGATAACCAGATCTAACAGCAGAATCAGGGTTCAAACTGTCAGTCTTCAGTCAGACTTCAGTCAGACCAGATAACCAGATCTAACAGCAGAATCAGGGTTCAAACTGTCAGTCTTCAGTCAGACCAGATAACCAGATCTAACAGCAGAATCAGGGATCAAACTGTCAGTCTTCAGTCAGACCAGATAACCAGATCTAA

Function


NR:

description
PREDICTED: histidine--tRNA ligase, cytoplasmic isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU117946 False 365 lncRNA 0.43 2 1070316 1070930
TU117947 True 262 lncRNA 0.39 2 1070316 1070930
Loading

Neighbor


gene id symbol gene type direction distance location
azi2 azi2 coding downstream 164898 879818 ~ 905418 (-)
eomesb eomesb coding downstream 257126 806150 ~ 813190 (-)
LOC110516483 LOC106573240 coding downstream 279445 727654 ~ 790871 (-)
LOC118937315 NA coding downstream 393804 672497 ~ 676512 (-)
LOC118937314 NA coding downstream 562247 423319 ~ 508560 (-)
LOC118937319 NA coding upstream 244734 1314565 ~ 1316245 (-)
LOC110515934 gadl1 coding upstream 356321 1427251 ~ 1457133 (-)
LOC110515405 LOC106590999 coding upstream 502472 1573402 ~ 1683489 (-)
kiaa1143 k1143 coding upstream 632021 1702951 ~ 1704863 (-)
zdhhc3a zdhhc3 coding upstream 638586 1709516 ~ 1732333 (-)
G104823 NA non-coding downstream 3109 1066563 ~ 1067207 (-)
G104821 NA non-coding downstream 5316 1063986 ~ 1065000 (-)
G104817 NA non-coding downstream 16830 1052528 ~ 1053486 (-)
G104807 NA non-coding downstream 36236 1030898 ~ 1034080 (-)
G104699 NA non-coding downstream 53550 1016420 ~ 1016766 (-)
G104827 NA non-coding upstream 1934 1072864 ~ 1073877 (-)
G104838 NA non-coding upstream 39098 1110028 ~ 1111287 (-)
G104842 NA non-coding upstream 47773 1118703 ~ 1126657 (-)
G104857 NA non-coding upstream 88049 1158979 ~ 1159494 (-)
G104863 NA non-coding upstream 102404 1173334 ~ 1174778 (-)
G105220 NA other upstream 263056 1333986 ~ 1342335 (-)
G105285 NA other upstream 469800 1540730 ~ 1541706 (-)
G105340 NA other upstream 570337 1641267 ~ 1641732 (-)
G105427 NA other upstream 841662 1912592 ~ 1917188 (-)

Expression


G104825 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G104825 Expression in each Bioproject

Bar chart with 10 bars.
G104825 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network