G105340



Basic Information


Item Value
gene id G105340
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 1641267 ~ 1641732 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU118763
GTCCCAACATGCATTTGTCAATTTGTAGAACACCTCAGCTGTTCCTACATAGAGATTCATCCAGCAGGTACCTGCTCTTTGATTGGCTGGGCCGTACAGATTCACCCAGCAGTTACCTGCTCCTTGGATGGCCGGGCCGTACAGATTCACCCAGCAGTTACCTGCTCCTTGGATGGCCGGGCCGTACAGATTCACCCAGCAGTTACCTGCTCCTTGGATGGCTGGGCCGTACAGATTCACCCAGCAGTTACCTGCTCCTTGGATGGCCGGGCCGTACAGATTCACC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU118763 True 286 TUCP 0.37 2 1641267 1641732
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110515934 gadl1 coding downstream 184134 1427251 ~ 1457133 (-)
LOC118937319 NA coding downstream 325022 1314565 ~ 1316245 (-)
azi2 azi2 coding downstream 735849 879818 ~ 905418 (-)
eomesb eomesb coding downstream 828077 806150 ~ 813190 (-)
LOC110516483 LOC106573240 coding downstream 850396 727654 ~ 790871 (-)
kiaa1143 k1143 coding upstream 61219 1702951 ~ 1704863 (-)
zdhhc3a zdhhc3 coding upstream 67784 1709516 ~ 1732333 (-)
nrsn1 nrsn1 coding upstream 279278 1921010 ~ 1925939 (-)
LOC118937333 NA coding upstream 660904 2302636 ~ 2303881 (-)
LOC118937335 NA coding upstream 788543 2273420 ~ 2440302 (-)
G105320 NA non-coding downstream 41766 1576280 ~ 1599501 (-)
G105327 NA non-coding downstream 42501 1597159 ~ 1598766 (-)
G105325 NA non-coding downstream 49816 1589586 ~ 1591451 (-)
G105323 NA non-coding downstream 51816 1587039 ~ 1589451 (-)
G105324 NA non-coding downstream 52317 1587535 ~ 1588950 (-)
G105341 NA non-coding upstream 48 1641780 ~ 1642098 (-)
G105342 NA non-coding upstream 735 1642467 ~ 1642673 (-)
G105347 NA non-coding upstream 7221 1648953 ~ 1649269 (-)
G105349 NA non-coding upstream 10357 1652089 ~ 1652332 (-)
G105350 NA non-coding upstream 11831 1653563 ~ 1653809 (-)
LOC110515405 LOC106590999 other downstream 22231 1573402 ~ 1683489 (-)
G105285 NA other downstream 99561 1540730 ~ 1541706 (-)
G105220 NA other downstream 298932 1333986 ~ 1342335 (-)
G105427 NA other upstream 270860 1912592 ~ 1917188 (-)
G105428 NA other upstream 275619 1917351 ~ 1918027 (-)
G105492 NA other upstream 316752 1958484 ~ 1961587 (-)
G105636 NA other upstream 476347 2118079 ~ 2120501 (-)
G105938 NA other upstream 721267 2362999 ~ 2363531 (-)

Expression


G105340 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G105340 Expression in each Bioproject

Bar chart with 16 bars.
G105340 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network