G105381



Basic Information


Item Value
gene id G105381
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 1689966 ~ 1693400 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU118810
ggttagtgagaggtgttactagcagttagtggttagtgagaggtgttactagcagttagtggttagtgagaggtgttactagtggttagtggttagtgagaggtgttactagtggttagtggttagtgagaggtgttactagtggttagtggttagtgagaggtgttactagtgtttagtggttagtgagaggtgttactagtggttagtggttagtgtttagtgagaggtgttactagtgtttagtggttagtgagaggtgttactagtggttagtg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU118810 True 278 lncRNA 0.42 3 1689966 1693400

Neighbor


gene id symbol gene type direction distance location
LOC110515405 LOC106590999 coding downstream 6477 1573402 ~ 1683489 (-)
LOC110515934 gadl1 coding downstream 232833 1427251 ~ 1457133 (-)
LOC118937319 NA coding downstream 373721 1314565 ~ 1316245 (-)
azi2 azi2 coding downstream 784548 879818 ~ 905418 (-)
eomesb eomesb coding downstream 876776 806150 ~ 813190 (-)
kiaa1143 k1143 coding upstream 9551 1702951 ~ 1704863 (-)
zdhhc3a zdhhc3 coding upstream 16116 1709516 ~ 1732333 (-)
nrsn1 nrsn1 coding upstream 227610 1921010 ~ 1925939 (-)
LOC118937333 NA coding upstream 609236 2302636 ~ 2303881 (-)
LOC118937335 NA coding upstream 736875 2273420 ~ 2440302 (-)
G105376 NA non-coding downstream 10050 1679618 ~ 1679916 (-)
G105368 NA non-coding downstream 11918 1668015 ~ 1678048 (-)
G105356 NA non-coding downstream 29313 1660230 ~ 1660653 (-)
G105355 NA non-coding downstream 31498 1658184 ~ 1658468 (-)
G105385 NA non-coding upstream 7971 1701371 ~ 1702470 (-)
G105386 NA non-coding upstream 14163 1707563 ~ 1707903 (-)
G105394 NA non-coding upstream 43302 1736702 ~ 1736975 (-)
G105402 NA non-coding upstream 63003 1756403 ~ 1756941 (-)
G105406 NA non-coding upstream 68915 1762315 ~ 1764283 (-)
G105340 NA other downstream 48234 1641267 ~ 1641732 (-)
G105285 NA other downstream 148260 1540730 ~ 1541706 (-)
G105220 NA other downstream 347631 1333986 ~ 1342335 (-)
G105427 NA other upstream 219192 1912592 ~ 1917188 (-)
G105428 NA other upstream 223951 1917351 ~ 1918027 (-)
G105492 NA other upstream 265084 1958484 ~ 1961587 (-)
G105636 NA other upstream 424679 2118079 ~ 2120501 (-)
G105938 NA other upstream 669599 2362999 ~ 2363531 (-)

Expression


G105381 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G105381 Expression in each Bioproject

Bar chart with 14 bars.
G105381 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 500.
End of interactive chart.

Co-expression Network