G105361



Basic Information


Item Value
gene id G105361
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 1799666 ~ 1799990 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU118788
TATTCTGTCTTCCCTTAAAGCCTTATACACAGCTGGTTCTATTCTGTATTCCCTTAAAGCCTTATACACTGCTGGTTCTATTCTGTCTTCCCTTAAAGCCTTATACACAGCTGGTTCTATTCTGTCTTCCCTTAAAGCCTTATACACAGCTGGTTCTATTCTGTCTTCCCTTAAAGCCTTATACACTGCTGGTTCTATTCTGTCTTCCCTTAAAGCCTTATACACAGCTGGTTCTATTCTGTCTTCCCTTAAAGCCTTATACACTGCTGGTTCTATTCTGTCTTCCCTTAAAGCCTTATACACAGCTGGTTCTATTCTGTTTTCA

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU118788 True 325 lncRNA 0.40 1 1799666 1799990
Loading

Neighbor


gene id symbol gene type direction distance location
zdhhc3a zdhhc3 coding downstream 67333 1709516 ~ 1732333 (-)
kiaa1143 k1143 coding downstream 94803 1702951 ~ 1704863 (-)
LOC110515405 LOC106590999 coding downstream 116177 1573402 ~ 1683489 (-)
LOC110515934 gadl1 coding downstream 342533 1427251 ~ 1457133 (-)
LOC118937319 NA coding downstream 483421 1314565 ~ 1316245 (-)
nrsn1 nrsn1 coding upstream 121020 1921010 ~ 1925939 (-)
LOC118937333 NA coding upstream 502646 2302636 ~ 2303881 (-)
LOC118937335 NA coding upstream 630285 2273420 ~ 2440302 (-)
sox4b sox4 coding upstream 646384 2446374 ~ 2449761 (-)
LOC110512766 LOC106593784 coding upstream 713720 2513710 ~ 2516419 (-)
G105418 NA non-coding downstream 9941 1788390 ~ 1789725 (-)
G105409 NA non-coding downstream 22679 1775935 ~ 1776987 (-)
G105406 NA non-coding downstream 35383 1762315 ~ 1764283 (-)
G105402 NA non-coding downstream 42725 1756403 ~ 1756941 (-)
G105394 NA non-coding downstream 62691 1736702 ~ 1736975 (-)
G105360 NA non-coding upstream 1327 1801317 ~ 1805294 (-)
G105364 NA non-coding upstream 5796 1805786 ~ 1806068 (-)
G105365 NA non-coding upstream 6201 1806191 ~ 1806427 (-)
G105423 NA non-coding upstream 12944 1812934 ~ 1813224 (-)
G105425 NA non-coding upstream 16880 1816870 ~ 1817281 (-)
G105340 NA other downstream 157934 1641267 ~ 1641732 (-)
G105285 NA other downstream 257960 1540730 ~ 1541706 (-)
G105220 NA other downstream 457331 1333986 ~ 1342335 (-)
G105427 NA other upstream 112602 1912592 ~ 1917188 (-)
G105428 NA other upstream 117361 1917351 ~ 1918027 (-)
G105492 NA other upstream 158494 1958484 ~ 1961587 (-)
G105636 NA other upstream 318089 2118079 ~ 2120501 (-)
G105938 NA other upstream 563009 2362999 ~ 2363531 (-)

Expression


G105361 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G105361 Expression in each Bioproject

Bar chart with 15 bars.
G105361 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network