G105556


Basic Information

Item Value
gene id G105556
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 2065137 ~ 2066926 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU119109
GGCAGAGAGGGGTACTGTAACTGACAATGTTAGAGAGAGGTACTGTAACTGACAATGGCAGAGAGAGGTACTGTAACTGACAACGTCAGAGAGAGGTACTGTAACTGACAATGTTAGAGAGAGGTACTGTAACTGACAACATCAGAGAGAGGTACTGTAACTGACAACATCAGAGAGAGGTACTGTAACTGACAACATCAGAGAGAGGTACTGTAACTGATAACGTCAGAGAG
>TU119111
GGCAGAGAGGGGTACTGTAACTGACAATGTTAGAGAGAGGTACTGTAACTGACAATGGCAGAGAGAGGTACTGTAACTGACAACGTCAGAGAGAGGTACTGTAACTGACAATGTTAGAGAGAGGTACTGTAACTGACAACATCAGAGAGAGGTACTGTAACTGACAACATCAGAGAGAGGTACTGTAACTGACAACATCAGAGAGAGGTACTGTATCTGACAATGGCAGAGAGAGGTACTGTATCTGACAATGGCAGAGAGAGGTACTGTATCTAACAATGGCAGAGAGAGGTACTGTATCTGACAATGGCAGAGAGAGGTACTGTATCTGACAATGGCAGAGAGAGGTACTGTATCTGACAATGGCAGAGAGAGGTACTGTATCTGACAATGGCAGAGAGAGGTACTGTATCTGACAATGGCAGAGAGAGGTACTGTATCTGACAATGGCAGAGAGAGGTACTGTATCTGACAAtggcagagagagggcagagagaggtacTGTATCTGACAATGGCAGAGGTACTGTAACTGATAACGTCAGAGAG

Function

NR:

description
PREDICTED: TRIO and F-actin-binding protein-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU119109 False 233 lncRNA 0.31 3 2065137 2066926
TU119111 True 548 lncRNA 0.35 3 2065137 2066926

Neighbor

gene id symbol gene type direction distance location
LOC110511503 LOC106605726 coding upstream 163689 1865365 ~ 1901456 (+)
slc6a3 slc6a3 coding upstream 211567 1816808 ~ 1853570 (+)
LOC110514512 LOC105016610 coding upstream 270199 1745298 ~ 1794938 (+)
tmem42a LOC106595323 coding upstream 357462 1704889 ~ 1707675 (+)
gpd1l LOC105023484 coding upstream 366768 1683561 ~ 1698369 (+)
LOC110516539 NA coding downstream 49627 2116553 ~ 2120455 (+)
LOC118944029 NA coding downstream 99195 2166121 ~ 2177996 (+)
LOC118944030 NA coding downstream 351260 2418186 ~ 2420621 (+)
LOC118937340 NA coding downstream 911310 2978236 ~ 2978524 (+)
LOC118937337 NA coding downstream 911860 2978786 ~ 2980193 (+)
G105548 NA non-coding upstream 14823 2048681 ~ 2050314 (+)
G105536 NA non-coding upstream 35171 2028765 ~ 2029966 (+)
G105529 NA non-coding upstream 47020 2016077 ~ 2018117 (+)
G105527 NA non-coding upstream 57916 2006461 ~ 2007221 (+)
G105525 NA non-coding upstream 62606 2001989 ~ 2002531 (+)
G105571 NA non-coding downstream 34029 2100955 ~ 2101640 (+)
G105572 NA non-coding downstream 36455 2103381 ~ 2107628 (+)
G105639 NA non-coding downstream 56569 2123495 ~ 2124035 (+)
G105642 NA non-coding downstream 65829 2132755 ~ 2133621 (+)
G105654 NA non-coding downstream 81540 2148466 ~ 2148711 (+)
G105042 NA other upstream 354580 1708969 ~ 1710557 (+)
G105036 NA other upstream 364706 1699073 ~ 1700431 (+)
tgfbr2b LOC106606173 other upstream 712274 1309202 ~ 1390936 (+)
G104761 NA other upstream 911388 1153061 ~ 1153749 (+)
cmc1 cc068 other upstream 1192622 860459 ~ 872515 (+)
G106019 NA other downstream 453790 2520716 ~ 2527972 (+)
G106122 NA other downstream 651035 2717961 ~ 2718525 (+)
G106240 NA other downstream 907897 2974823 ~ 3039475 (+)
G106253 cdkal other downstream 1139871 3006312 ~ 3391033 (+)
mboat1 LOC106573215 other downstream 1300279 3350582 ~ 3487129 (+)

Expression


Co-expression Network