G105997



Basic Information


Item Value
gene id G105997
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 2479196 ~ 2480550 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU119705
GTCTAGTATAGTATAATGATCACAACCCAGATTAACAACACACAGCTAGGTGGGTCTAGTATAGTATAATGACCACAACCCAGATTAACAACACACAGCTAGGTGGGTCTAGTATAGTATAATGATCACAACCCAGATTAACAACACACAGCTAGGTGGGTCTAGTATAGTATAATGACCACAACCCAGATTAACAACACACAGCTAGGTGGGTCTAGTATAGTATAATGATCACAACCCAGATTAACAACACACAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU119705 True 257 lncRNA 0.33 2 2479196 2480550
Loading

Neighbor


gene id symbol gene type direction distance location
sox4b sox4 coding downstream 29435 2446374 ~ 2449761 (-)
LOC118937335 NA coding downstream 38894 2273420 ~ 2440302 (-)
LOC118937333 NA coding downstream 175315 2302636 ~ 2303881 (-)
nrsn1 nrsn1 coding downstream 553257 1921010 ~ 1925939 (-)
zdhhc3a zdhhc3 coding downstream 746863 1709516 ~ 1732333 (-)
LOC110512766 LOC106593784 coding upstream 33160 2513710 ~ 2516419 (-)
LOC110514306 NA coding upstream 37637 2518187 ~ 2519022 (-)
LOC110511524 NA coding upstream 53252 2533802 ~ 2536162 (-)
cdkal1 cdkal coding upstream 164340 2644890 ~ 3391012 (-)
LOC118937342 e2f3 coding upstream 912096 3392063 ~ 3405112 (-)
G105996 NA non-coding downstream 1646 2475370 ~ 2477550 (-)
G105995 NA non-coding downstream 4170 2474692 ~ 2475026 (-)
G105994 NA non-coding downstream 4677 2473194 ~ 2474519 (-)
G105992 NA non-coding downstream 8686 2469573 ~ 2470510 (-)
G105990 NA non-coding downstream 14559 2464363 ~ 2464637 (-)
G106000 NA non-coding upstream 1719 2482269 ~ 2482478 (-)
G106005 NA non-coding upstream 4648 2485198 ~ 2485622 (-)
G106043 NA non-coding upstream 72310 2552860 ~ 2553853 (-)
G106044 NA non-coding upstream 73447 2553997 ~ 2554368 (-)
G106047 NA non-coding upstream 74956 2555506 ~ 2555721 (-)
G105938 NA other downstream 115665 2362999 ~ 2363531 (-)
G105636 NA other downstream 358695 2118079 ~ 2120501 (-)
G105492 NA other downstream 517609 1958484 ~ 1961587 (-)
G105428 NA other downstream 561169 1917351 ~ 1918027 (-)
G105427 NA other downstream 562201 1912592 ~ 1917188 (-)
G106001 NA other upstream 2391 2482941 ~ 2483356 (-)
G106003 NA other upstream 3310 2483860 ~ 2485123 (-)
LOC110506994 carmil1 other upstream 1272011 3705036 ~ 3924570 (-)
G107456 NA other upstream 1510776 3991326 ~ 3992847 (-)
G107574 NA other upstream 1814875 4295425 ~ 4296815 (-)

Expression


G105997 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G105997 Expression in each Bioproject

Bar chart with 9 bars.
G105997 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 350.
End of interactive chart.

Co-expression Network