G108934



Basic Information


Item Value
gene id G108934
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 6792011 ~ 6793179 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU123943
AGTTGTTAGAGAAGCACTATGTTTAACAGTATGGTATCTCTCCTATAGATCAGAACGTGGTCCAGGTTTTAGAGAAGCACTATGTTTAACAGTATGGTATCTCTCCTATAGATCAGTATGGTATCTCTCCTATAGATCAGTATGGTATCTCTCCTATAGATCAGTATGGTATCTCTCCTATAGATCAGAACGTGGTCCAGGTTTTAGAGAGGCACTATGTTTAACAGTATGGTATCTCTCCTATAGATCAGTATGGTATCTCTCCTATAGATCAGAACGTGGTCCAGGTTTTAGAGAAGCACTATGTTTAACAGTATGGTATCTCTCCTATAGATCAGTATGGTATC

Function


NR:

description
PREDICTED: ice nucleation protein-like isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU123943 True 347 lncRNA 0.30 2 6792011 6793179

Neighbor


gene id symbol gene type direction distance location
LOC110505984 LOC106574154 coding upstream 103999 6685900 ~ 6688012 (+)
ptdss1a LOC106595791 coding upstream 107195 6653202 ~ 6684816 (+)
LOC110505995 LOC106573077 coding upstream 142217 6645216 ~ 6649794 (+)
zgc:158766 LOC106590969 coding upstream 162542 6545368 ~ 6629469 (+)
LOC110506079 NA coding downstream 47853 6841032 ~ 6842093 (+)
rbm24b LOC106596654 coding downstream 62685 6855864 ~ 6868976 (+)
grinab grina coding downstream 82808 6875987 ~ 6889713 (+)
LOC118937417 LOC106592634 coding downstream 98269 6891448 ~ 6896287 (+)
smpd5 LOC106577403 coding downstream 104319 6897498 ~ 6908200 (+)
G108930 NA non-coding upstream 38082 6709124 ~ 6753929 (+)
G109032 NA non-coding upstream 119911 6670698 ~ 6672100 (+)
G109030 NA non-coding upstream 127281 6663269 ~ 6664730 (+)
G109019 NA non-coding upstream 165998 6624956 ~ 6626013 (+)
G109072 NA non-coding downstream 19615 6812794 ~ 6813416 (+)
G109080 NA non-coding downstream 50697 6843876 ~ 6844930 (+)
G109070 NA non-coding downstream 66493 6859672 ~ 6863903 (+)
G109085 NA non-coding downstream 70884 6864063 ~ 6864303 (+)
G109069 NA non-coding downstream 76421 6869600 ~ 6870945 (+)
G109020 NA other upstream 158098 6633078 ~ 6633913 (+)
G108874 LOC106573552 other upstream 506071 6282071 ~ 6285940 (+)
G108805 LOC106594197 other upstream 592670 6151712 ~ 6199341 (+)
G108775 LOC106606109 other upstream 733676 6056996 ~ 6058335 (+)
LOC110505679 LOC106579367 other upstream 789817 5976200 ~ 6002265 (+)
malsu1 malsu1 other downstream 115368 6908511 ~ 6911256 (+)
LOC110535156 LOC106606167 other downstream 148337 6941465 ~ 6944043 (+)
G109821 NA other downstream 342068 7135247 ~ 7140979 (+)
pde11al LOC106573285 other downstream 509849 7282430 ~ 7304709 (+)

Expression


G108934 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G108934 Expression in each Bioproject

Bar chart with 16 bars.
G108934 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network