G111516


Basic Information

Item Value
gene id G111516
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 8754468 ~ 8755236 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU127222
ctccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattgtggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacaacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgcaatatacgactgattgttgtcctatggacagagtctaccacctcagctgtagatctctgcagttcatccagagtgatcatgggcctcttggctgcatctctgatcagtcttctccttgtatgagctgaaagtttagagggacggccaggtcttggtagatttgcagtggtctgatactccttcaatttcaatattatcgcttgcacagtgctccttgggatgtttaaagcttgggaaatctttttgtatccaaatccggctttaaatttcttcacaacagtatctcggacctgcctggtgtgttccttgttcttcatgatgctctctgcgcttttaacggacctctgagactatcacagtgcaggtgcatttatacggagacttgattacacacaggtggattgtatttatcat

Function

NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU127222 True 769 lncRNA 0.44 1 8754468 8755236
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110535184 LOC106605879 coding downstream 2304 8693136 ~ 8752164 (-)
LOC110506629 LOC106573674 coding downstream 241107 8507579 ~ 8513361 (-)
LOC118936301 LOC106595809 coding downstream 282946 8466107 ~ 8471522 (-)
LOC118937639 LOC106573719 coding downstream 325148 8423811 ~ 8429320 (-)
LOC100136714 twst2 coding downstream 358992 8393785 ~ 8395476 (-)
LOC110519098 LOC106594466 coding upstream 14645 8769881 ~ 8782987 (-)
LOC110516599 LOC106606020 coding upstream 36400 8791636 ~ 8802003 (-)
LOC110514444 LOC108270036 coding upstream 48966 8804202 ~ 8819077 (-)
LOC110506642 LOC106606082 coding upstream 319537 9074773 ~ 9087920 (-)
LOC110506677 c4 coding upstream 361330 9116566 ~ 9141714 (-)
G111514 NA non-coding downstream 4105 8750084 ~ 8750363 (-)
G111508 NA non-coding downstream 16326 8737939 ~ 8738142 (-)
G111505 NA non-coding downstream 21676 8731349 ~ 8732792 (-)
G111181 NA non-coding downstream 82981 8671272 ~ 8671487 (-)
G111529 NA non-coding upstream 22877 8778113 ~ 8779056 (-)
G111533 NA non-coding upstream 28616 8783852 ~ 8784297 (-)
G111535 NA non-coding upstream 31996 8787232 ~ 8787572 (-)
G111576 NA non-coding upstream 145884 8901120 ~ 8901354 (-)
G111044 NA other downstream 231707 8522002 ~ 8522761 (-)
G111047 LOC106574003 other downstream 248864 8500104 ~ 8505604 (-)
G110896 NA other downstream 428788 8324960 ~ 8325680 (-)
G111650 NA other upstream 295053 9050289 ~ 9050798 (-)
G111659 NA other upstream 312376 9067612 ~ 9068062 (-)
G111855 NA other upstream 684126 9439362 ~ 9439938 (-)
G111955 NA other upstream 879301 9634537 ~ 9635130 (-)

Expression

G111516 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G111516 Expression in each Bioproject

Bar chart with 19 bars.
G111516 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network