G112619



Basic Information


Item Value
gene id G112619
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 10438553 ~ 10439091 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU128575
tgtctagttaaaccccatcatcctcagtaaagttgtttaaccaccaccatatgtctgtgtctagttaaaccccatcatcctcagtaaagttgtttaaccaccaccatatgtctagttaaaccccatcatcctcagtaaagatgtttaaccaccaccatatgtctagttaaaccccatcatcctcagtaaagttgtttaaccaccaccatatgtctagttaaaccccatcatcctcagtaaagttgtttaaccaccatatgtctgtgtctagttaaaccccatcatcctcagtaaagttgtttaaccaccactatatgtctgtgtctagttaaaccccatcatcctcagtaaagttgtttaaccaccatatgtctgtgtctagttaaaccccatcatcctcagtaaagttgtttaaccaccatatgtctagttaaaccccatcatcctcagtaaagttgtttaaccaccaccatatgtctgtgtctagttaaaccccatcatcctcagtaaagttgtttaaccaccaccatatgtctagt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU128575 True 539 lncRNA 0.41 1 10438553 10439091

Neighbor


gene id symbol gene type direction distance location
LOC110535244 ctnnb1 coding upstream 35908 10366101 ~ 10402645 (+)
LOC110507415 LOC106584755 coding upstream 141961 10293799 ~ 10296592 (+)
LOC110517641 LOC106584755 coding upstream 200174 10235740 ~ 10238379 (+)
LOC118937668 LOC106584755 coding upstream 218981 10217269 ~ 10219572 (+)
LOC110507434 LOC106584755 coding upstream 249438 10186105 ~ 10189115 (+)
LOC110507508 LOC106605488 coding downstream 187495 10626586 ~ 10710360 (+)
washc5 kiaa0196 coding downstream 592901 11031992 ~ 11083098 (+)
nsmce2 LOC106606151 coding downstream 645270 11084361 ~ 11097464 (+)
LOC110512016 LOC106564714 coding downstream 763796 11202887 ~ 11211212 (+)
fbxo32 fbxo32 coding downstream 788406 11227497 ~ 11243074 (+)
G112617 NA non-coding upstream 681 10437408 ~ 10437872 (+)
G112616 NA non-coding upstream 3718 10434560 ~ 10434835 (+)
G112613 NA non-coding upstream 10008 10428292 ~ 10428545 (+)
G112612 NA non-coding upstream 10327 10427813 ~ 10428226 (+)
G112610 NA non-coding upstream 15346 10422633 ~ 10423207 (+)
G112620 NA non-coding downstream 3221 10442312 ~ 10442937 (+)
G112622 NA non-coding downstream 4724 10443815 ~ 10444661 (+)
G112625 NA non-coding downstream 11462 10450553 ~ 10450799 (+)
G112637 NA non-coding downstream 50478 10489569 ~ 10490000 (+)
G112639 NA non-coding downstream 59978 10499069 ~ 10499335 (+)
LOC118937659 NA other upstream 662102 9773574 ~ 9776807 (+)
LOC110506952 LOC106606100 other upstream 714682 9701990 ~ 9742723 (+)
G111788 NA other upstream 994512 9440309 ~ 9444041 (+)
G111453 NA other upstream 1106937 9330269 ~ 9331616 (+)
LOC110535224 aif1 other upstream 1209528 9221418 ~ 9229025 (+)
G112697 NA other downstream 372427 10811518 ~ 10826063 (+)
elovl4a LOC106606161 other downstream 822463 11260912 ~ 11275480 (+)
G113285 NA other downstream 975840 11414931 ~ 11415178 (+)
G113313 LOC102781083 other downstream 1038885 11477976 ~ 11482741 (+)

Expression


G112619 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G112619 Expression in each Bioproject

Bar chart with 14 bars.
G112619 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network