G114105



Basic Information


Item Value
gene id G114105
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 12337877 ~ 12338131 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU130775
CACATCTCCATGACCCAGCTCCTCCTCTGGAGCTGAGGAGCATCTCACATCTCCATGACCCAGCTCCTCCACTGCAGCTGGGGAGCATCTCACATCTCCATGACCCAGCTCCTCCACTGGAGCTGAGGAGCATCTCACATCTCCATGACCCAGCTCCTCCACTGGAACTGGGGAGCATCTCACATCTCCATGACCCAGCTCCTCCACTGCAGCTGAGGAGCATCTCACATCTCCATGACCCAGCTCCTCCACTGG

Function


NR:

description
trichohyalin-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU130775 True 255 lncRNA 0.42 1 12337877 12338131
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110511179 NA coding upstream 37920 12299517 ~ 12300453 (+)
LOC110510416 LOC106596421 coding upstream 879446 11416206 ~ 11459325 (+)
fbxo43 fbxo43 coding upstream 924164 11402943 ~ 11413713 (+)
echdc1 echdc1 coding upstream 940569 11392942 ~ 11397308 (+)
soga3a LOC106593623 coding upstream 964877 11328026 ~ 11373000 (+)
LOC118944185 NA coding downstream 134109 12430935 ~ 12555437 (+)
LOC110513835 nipal2 coding downstream 224206 12562337 ~ 12616197 (+)
LOC110510520 rida coding downstream 335954 12674085 ~ 12680150 (+)
spag1b LOC106592835 coding downstream 378443 12716574 ~ 12776832 (+)
LOC110525149 LOC106589684 coding downstream 575500 12913631 ~ 12916798 (+)
G113644 LOC106572245 non-coding upstream 23597 12312808 ~ 12314280 (+)
G113634 LOC106591507 non-coding upstream 30030 12301209 ~ 12307847 (+)
G113619 NA non-coding upstream 63115 12274294 ~ 12274762 (+)
G113593 NA non-coding upstream 133689 12203682 ~ 12204188 (+)
G114125 NA non-coding downstream 19734 12357865 ~ 12358192 (+)
G114135 NA non-coding downstream 44679 12382810 ~ 12385066 (+)
G114140 NA non-coding downstream 68877 12407008 ~ 12408920 (+)
G114144 NA non-coding downstream 73913 12412044 ~ 12414925 (+)
G113396 NA other upstream 628100 11708603 ~ 11709777 (+)
G113313 LOC102781083 other upstream 855136 11477976 ~ 11482741 (+)
G113285 NA other upstream 922699 11414931 ~ 11415178 (+)
elovl4a LOC106606161 other upstream 1064877 11260912 ~ 11275480 (+)
fbxo32 fbxo32 other upstream 1094808 11227497 ~ 11243074 (+)
G114243 NA other downstream 382277 12720408 ~ 12720693 (+)
G114244 NA other downstream 382599 12720730 ~ 12721315 (+)
G114263 NA other downstream 424101 12762232 ~ 12762827 (+)
G114323 NA other downstream 611229 12949360 ~ 12964930 (+)
LOC110520769 LOC106593286 other downstream 1283846 13604304 ~ 13623972 (+)

Expression


G114105 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G114105 Expression in each Bioproject

Bar chart with 5 bars.
G114105 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network