G114259



Basic Information


Item Value
gene id G114259
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 12750848 ~ 12751314 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU131064
CTGGATCCAGCCAATCAGTAATTACAGCAGTTAAACTAGGGAAGTTCTGGAGGAGACAACACTATAGAGGAGGCCTTGTTGGTCTGGTTGAACCCATAGAGTGAGGCTTGGTTGGTCTGGTTGAAACCATAGAGGAGGCTTGGTTGGTCTGGTTGAAACCATAGAGGAGGCTTGGTTGGTCTGGTTGGTCTGGTTGAAACCATAGAGGAGGCTTGGTTGGTCTGGTTGAAACCATAGAGGAGGCTTGGTTGGTCTGGTTGAAACCATAGAGGAGGCTTGGTTGGTCTGGTTGAAACCATAGAGGAGGCTTGGCTGGTCTGGTTGGTCTGGTTGAAACCATAGTGGAGGCTTGGCTGCTCTGGTTGGTCTGGTTGAAACCATAGTGGAGG

Function


NR:

description
PREDICTED: oxidation resistance protein 1-like isoform X3

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU131064 True 389 lncRNA 0.41 2 12750848 12751314
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110510520 rida coding upstream 70698 12674085 ~ 12680150 (+)
LOC110513835 nipal2 coding upstream 134651 12562337 ~ 12616197 (+)
LOC118944185 NA coding upstream 278418 12430935 ~ 12555437 (+)
LOC110511179 NA coding upstream 450891 12299517 ~ 12300453 (+)
LOC110510416 LOC106596421 coding upstream 1292417 11416206 ~ 11459325 (+)
LOC110525149 LOC106589684 coding downstream 162317 12913631 ~ 12916798 (+)
LOC118937726 NA coding downstream 175507 12926821 ~ 12927702 (+)
LOC110507515 LOC106575761 coding downstream 295565 13046879 ~ 13061306 (+)
LOC118936508 ano10 coding downstream 441831 13193145 ~ 13241855 (+)
LOC110507612 NA coding downstream 573623 13324937 ~ 13330676 (+)
G114248 NA non-coding upstream 19767 12730670 ~ 12731081 (+)
spag1b LOC106592835 non-coding upstream 23269 12716574 ~ 12776832 (+)
G114234 NA non-coding upstream 34659 12715933 ~ 12716189 (+)
G114228 NA non-coding upstream 54415 12696180 ~ 12696433 (+)
G114221 NA non-coding upstream 64981 12682744 ~ 12685867 (+)
G114268 NA non-coding downstream 18031 12769345 ~ 12769763 (+)
G114270 NA non-coding downstream 20869 12772183 ~ 12772913 (+)
G114271 NA non-coding downstream 28997 12780311 ~ 12780669 (+)
G114272 NA non-coding downstream 58608 12809922 ~ 12810124 (+)
G114235 NA non-coding downstream 62366 12813680 ~ 12817484 (+)
G114244 NA other upstream 29533 12720730 ~ 12721315 (+)
G114243 NA other upstream 30155 12720408 ~ 12720693 (+)
G113396 NA other upstream 1041071 11708603 ~ 11709777 (+)
G113313 LOC102781083 other upstream 1268107 11477976 ~ 11482741 (+)
G113285 NA other upstream 1335670 11414931 ~ 11415178 (+)
G114263 NA other downstream 10918 12762232 ~ 12762827 (+)
G114323 NA other downstream 198046 12949360 ~ 12964930 (+)
LOC110520769 LOC106593286 other downstream 870663 13604304 ~ 13623972 (+)
LOC110520780 LOC106574729 other downstream 950296 13663839 ~ 13756558 (+)
LOC110535330 LOC106574784 other downstream 1209947 13961020 ~ 13976561 (+)

Expression


G114259 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G114259 Expression in each Bioproject

Bar chart with 20 bars.
G114259 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network