G114655



Basic Information


Item Value
gene id G114655
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 13267344 ~ 13267562 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU131598
aaaaaaagtatttagtcagccaccaattgtgcaagttctcccacttaaaaagatgagaggcctgtaattttcatcataggtacacttcaactatgacagacaaaatgagaagaaaaaaatccagaaaatcacattgtaggatttttaatgaatttatttgcaaattatggtggaaaataagtatttgttcaataacaaaagtttatctcaatactttgt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU131598 True 219 lncRNA 0.29 1 13267344 13267562

Neighbor


gene id symbol gene type direction distance location
LOC118936508 ano10 coding upstream 25489 13193145 ~ 13241855 (+)
LOC110507515 LOC106575761 coding upstream 206038 13046879 ~ 13061306 (+)
LOC118937726 NA coding upstream 339642 12926821 ~ 12927702 (+)
LOC110525149 LOC106589684 coding upstream 350546 12913631 ~ 12916798 (+)
spag1b LOC106592835 coding upstream 490512 12716574 ~ 12776832 (+)
LOC110507612 NA coding downstream 57375 13324937 ~ 13330676 (+)
LOC110507631 LOC106574283 coding downstream 115626 13383188 ~ 13387921 (+)
LOC110517609 sbp1 coding downstream 306935 13574497 ~ 13582605 (+)
LOC110507693 LOC106574548 coding downstream 316562 13584124 ~ 13604148 (+)
LOC110520769 LOC106593286 coding downstream 336742 13604304 ~ 13623972 (+)
G114653 NA non-coding upstream 974 13266158 ~ 13266370 (+)
G114652 NA non-coding upstream 1737 13265328 ~ 13265607 (+)
G114648 NA non-coding upstream 7699 13259358 ~ 13259645 (+)
G114643 NA non-coding upstream 19133 13246762 ~ 13248211 (+)
G114620 NA non-coding upstream 77038 13190075 ~ 13190306 (+)
G114656 NA non-coding downstream 35485 13303047 ~ 13304633 (+)
G114687 NA non-coding downstream 63196 13330758 ~ 13332453 (+)
G114689 LOC106606048 non-coding downstream 71402 13338964 ~ 13344183 (+)
G114712 NA non-coding downstream 162139 13429701 ~ 13431706 (+)
G114323 NA other upstream 302414 12949360 ~ 12964930 (+)
G114263 NA other upstream 504517 12762232 ~ 12762827 (+)
G114244 NA other upstream 546029 12720730 ~ 12721315 (+)
G114243 NA other upstream 546651 12720408 ~ 12720693 (+)
G113396 NA other upstream 1557567 11708603 ~ 11709777 (+)
LOC110520780 LOC106574729 other downstream 434048 13663839 ~ 13756558 (+)
LOC110535330 LOC106574784 other downstream 693699 13961020 ~ 13976561 (+)
G115190 NA other downstream 874320 14141882 ~ 14144267 (+)
G115189 NA other downstream 966952 14234514 ~ 14236854 (+)

Expression


G114655 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G114655 Expression in each Bioproject

Bar chart with 20 bars.
G114655 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network