G114717



Basic Information


Item Value
gene id G114717
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 13441854 ~ 13473747 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU131680
tgagaccctggccacccaagtctccaacctcacagaacaggttcaccatctccgccggccacttccagggctttcgaatctccggagcccagaatcaataacccgccgtgttactctggggagcccactgaatgccgctcgttcctcacccagtgtgatattgtgttttctctccagcccaacacttactccaggagcactgctcgtatcgcctacgtcatatctctccttactggacgggctcgtgagtggggcacggcaatctgggaggcaagggctgagtgtactaaccagtatcaggactttaaggaggagatgatacgggtttttgatcgatctgtttttggggaggaagcttccagggtcctgtcttccctatgtcaaggtaatcgatccataacagactactctattgagtttcgcactcttgctgcctccagtgactggaacgagccg

Function


NR:

description
PREDICTED: protein LDOC1-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU131680 True 456 lncRNA 0.36 2 13441854 13473747

Neighbor


gene id symbol gene type direction distance location
LOC110507631 LOC106574283 coding upstream 53933 13383188 ~ 13387921 (+)
LOC110507612 NA coding upstream 111178 13324937 ~ 13330676 (+)
LOC118936508 ano10 coding upstream 199999 13193145 ~ 13241855 (+)
LOC110507515 LOC106575761 coding upstream 380548 13046879 ~ 13061306 (+)
LOC118937726 NA coding upstream 514152 12926821 ~ 12927702 (+)
LOC110517609 sbp1 coding downstream 100750 13574497 ~ 13582605 (+)
LOC110507693 LOC106574548 coding downstream 110377 13584124 ~ 13604148 (+)
LOC110520769 LOC106593286 coding downstream 130557 13604304 ~ 13623972 (+)
LOC110513073 prune1 coding downstream 150886 13624633 ~ 13630579 (+)
LOC110520770 LOC106606072 coding downstream 159188 13632935 ~ 13643895 (+)
G114712 NA non-coding upstream 10148 13429701 ~ 13431706 (+)
G114689 LOC106606048 non-coding upstream 97671 13338964 ~ 13344183 (+)
G114687 NA non-coding upstream 109401 13330758 ~ 13332453 (+)
G114656 NA non-coding upstream 137221 13303047 ~ 13304633 (+)
G114897 NA non-coding downstream 209949 13683696 ~ 13684785 (+)
G114904 NA non-coding downstream 244485 13718232 ~ 13718727 (+)
G114990 NA non-coding downstream 260981 13734728 ~ 13734956 (+)
LOC110520780 LOC106574729 non-coding downstream 281177 13663839 ~ 13756558 (+)
G115009 NA non-coding downstream 288076 13761823 ~ 13762180 (+)
G114323 NA other upstream 476924 12949360 ~ 12964930 (+)
G114263 NA other upstream 679027 12762232 ~ 12762827 (+)
G114244 NA other upstream 720539 12720730 ~ 12721315 (+)
G114243 NA other upstream 721161 12720408 ~ 12720693 (+)
G113396 NA other upstream 1732077 11708603 ~ 11709777 (+)
LOC110535330 LOC106574784 other downstream 487514 13961020 ~ 13976561 (+)
G115190 NA other downstream 668135 14141882 ~ 14144267 (+)
G115189 NA other downstream 760767 14234514 ~ 14236854 (+)

Expression


G114717 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G114717 Expression in each Bioproject

Bar chart with 20 bars.
G114717 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network