G115825


Basic Information

Item Value
gene id G115825
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 14956219 ~ 14956421 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU133094
CGTTGATCCTCTCACGGCCAAGCCACTTCTTAAACTCCGCCCCCCAGTTCTGCACCAGGCTGCCAGGGGCAACCACCAGCACAAGCTTAGCAACCGGCTTCCCGCCGTATGGGCCCTGCTTTAGCAGCGTCCATGTCAAAGCCACGCTCTGGAGGGTCTTACCCAGACCCATCTCATCTGCCAGGATAGCACCGTACCTACAT

Function

NR:

description
DNA repair and recombination protein RAD54B-like, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU133094 True 203 lncRNA 0.38 1 14956219 14956421

Neighbor

gene id symbol gene type direction distance location
LOC110535729 LOC106606054 coding upstream 63367 14882494 ~ 14892852 (+)
tmem67 LOC106606053 coding upstream 73982 14870805 ~ 14882237 (+)
si:ch211-197h24.6 LOC106574428 coding upstream 88506 14860649 ~ 14867713 (+)
LOC110535632 invs coding upstream 118624 14794202 ~ 14837595 (+)
stx17 stx17 coding upstream 181751 14753455 ~ 14775822 (+)
rnf41l LOC106570746 coding downstream 17920 14974341 ~ 14981270 (+)
esrp1 LOC106605950 coding downstream 49135 15005556 ~ 15026595 (+)
LOC110533650 LOC106592818 coding downstream 112247 15068668 ~ 15076619 (+)
LOC110520775 LOC106605953 coding downstream 123206 15079627 ~ 15091353 (+)
LOC110508003 LOC106605954 coding downstream 138475 15094896 ~ 15108480 (+)
G115823 NA non-coding upstream 1326 14953626 ~ 14954893 (+)
G115812 NA non-coding upstream 18613 14937332 ~ 14937606 (+)
G115810 NA non-coding upstream 22080 14933898 ~ 14934139 (+)
G115801 NA non-coding upstream 41830 14912370 ~ 14914389 (+)
G115785 NA non-coding upstream 61311 14893700 ~ 14894908 (+)
G115826 NA non-coding downstream 458 14956879 ~ 14957590 (+)
G115853 NA non-coding downstream 59981 15016402 ~ 15016782 (+)
G115858 NA non-coding downstream 120302 15076723 ~ 15077344 (+)
G115880 NA non-coding downstream 125576 15081997 ~ 15082281 (+)
sec61b sc61b other upstream 391106 14556397 ~ 14565113 (+)
G115289 NA other upstream 548307 14406044 ~ 14407912 (+)
G115854 NA other downstream 74018 15030439 ~ 15031445 (+)
G116207 NA other downstream 314781 15271202 ~ 15271609 (+)
LOC110535811 acbd7 other downstream 373161 15329572 ~ 15336358 (+)

Expression


Co-expression Network