G116208



Basic Information


Item Value
gene id G116208
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 15271936 ~ 15272210 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU133566
ctgagaccagcatctctttatttagacagggagtcaatgctgagaccaaggtctctttatttagacaggtagtcaatgctgagaccaaggtgtctttatttagacagggagtcaatgctgagacagggagtcaatgctgagaccaaggtctctttatttagacagggagtcaatgctgagaccaaggtctctttatttagacagggagtcaatgctgagaccaaggtctctttatt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU133566 True 236 lncRNA 0.39 2 15271936 15272210
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110507970 LOC106606114 coding upstream 101503 15160172 ~ 15170433 (+)
LOC110508003 LOC106605954 coding upstream 163456 15094896 ~ 15108480 (+)
LOC110520775 LOC106605953 coding upstream 180583 15079627 ~ 15091353 (+)
LOC110533650 LOC106592818 coding upstream 195317 15068668 ~ 15076619 (+)
esrp1 LOC106605950 coding upstream 245341 15005556 ~ 15026595 (+)
LOC110535774 LOC106576081 coding downstream 43390 15315600 ~ 15326000 (+)
LOC110535811 acbd7 coding downstream 57362 15329572 ~ 15336358 (+)
LOC110535783 LOC106606004 coding downstream 83638 15355848 ~ 15368210 (+)
LOC110534183 LOC106576069 coding downstream 102427 15374637 ~ 15400616 (+)
rundc3b LOC106576055 coding downstream 165682 15437892 ~ 15448698 (+)
G116205 NA non-coding upstream 4618 15267117 ~ 15267318 (+)
G116197 NA non-coding upstream 8666 15262680 ~ 15263270 (+)
G115937 NA non-coding upstream 17733 15249817 ~ 15254203 (+)
G115924 NA non-coding upstream 18252 15205423 ~ 15253684 (+)
G116209 NA non-coding downstream 3963 15276173 ~ 15276467 (+)
G116210 NA non-coding downstream 5741 15277951 ~ 15278283 (+)
G116211 NA non-coding downstream 12815 15285025 ~ 15285953 (+)
G116212 NA non-coding downstream 13836 15286046 ~ 15286284 (+)
G116213 NA non-coding downstream 14290 15286500 ~ 15286770 (+)
G116207 NA other upstream 327 15271202 ~ 15271609 (+)
G115854 NA other upstream 240491 15030439 ~ 15031445 (+)
tmem67 LOC106606053 other upstream 393261 14870805 ~ 14882237 (+)
G116224 NA other downstream 65220 15337430 ~ 15337702 (+)
LOC110535842 LOC106605985 other downstream 178258 15448845 ~ 15451856 (+)
G117048 NA other downstream 911476 16182890 ~ 16185784 (+)

Expression


G116208 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G116208 Expression in each Bioproject

Bar chart with 14 bars.
G116208 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network