G119708 (LOC106591967)



Basic Information


Item Value
gene id G119708
gene name LOC106591967
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 19143701 ~ 19144055 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU138118
CCTCGTTCTCCTTGAGCAGCCTACGCGTGCGTGCCCCTCCCGGGTCGTCCGTCACGTTCAGCATGACCACGCTCTTCTTCTCCCAGCCGATGAACGAGCCGTCCGTCAGGCCGTCCACCACTGACAGGAAGTCCTGGTAGCCATGGTGACGGGTGGACACCACTGAGAAGGTGGTCCAGTCATACTCCTCTAGTATTTTGAAGATGACCTCCAGCTGGAGGCTGGTGGATGAGCTGAACTGGAGGAAGATGGAGCCTGACTCCTGCAGTAGAGGAGCACACCTTAAAGTTCTATAGACACAGGCAAGCACACGGGACAGAACGCTGCCAAACAGGAAGCACAACATCAGCTTTCC

Function


NR:

description
PREDICTED: glutamate receptor ionotropic, delta-2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU138118 True 355 lncRNA 0.57 1 19143701 19144055
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110508916 LOC106605783 coding downstream 65748 19062094 ~ 19077953 (-)
josd2 josd2 coding downstream 385905 18755291 ~ 18757796 (-)
LOC110536927 LOC106577129 coding downstream 435070 18695833 ~ 18708631 (-)
LOC110536908 LOC106605765 coding downstream 449881 18688948 ~ 18693820 (-)
grwd1 grwd1 coding downstream 471291 18662604 ~ 18672410 (-)
cacng6b LOC106606119 coding upstream 340273 19484328 ~ 19499142 (-)
u2af2a u2af2 coding upstream 362613 19506668 ~ 19513981 (-)
LOC110534365 LOC106576897 coding upstream 370224 19514279 ~ 19524832 (-)
LOC110537080 LOC106576890 coding upstream 383940 19527995 ~ 19548154 (-)
LOC110537104 LOC106605828 coding upstream 410863 19554918 ~ 19556242 (-)
G119644 NA non-coding downstream 4299 19139177 ~ 19139402 (-)
G119705 NA non-coding downstream 7470 19135972 ~ 19136231 (-)
G119704 NA non-coding downstream 8640 19134848 ~ 19135061 (-)
G119701 LOC106605741 non-coding downstream 11525 19131882 ~ 19132176 (-)
G119646 NA non-coding downstream 114196 19029003 ~ 19029505 (-)
G119722 NA non-coding upstream 48805 19192860 ~ 19193084 (-)
G119735 NA non-coding upstream 63424 19207479 ~ 19214105 (-)
G119734 NA non-coding upstream 76616 19220671 ~ 19247467 (-)
G119740 NA non-coding upstream 113570 19257625 ~ 19258069 (-)
G119741 NA non-coding upstream 116190 19260245 ~ 19262206 (-)
G119663 NA other downstream 94671 19048307 ~ 19049030 (-)
G119512 LOC105019016 other downstream 342314 18799500 ~ 18801387 (-)
LOC110534340 LOC106605761 other downstream 497038 18627912 ~ 18646884 (-)
LOC110536756 ndufa3 other downstream 601204 18541050 ~ 18543176 (-)
G119087 LOC106605728 other downstream 666948 18476454 ~ 18476753 (-)
LOC118944062 LOC106575151 other upstream 549634 19692971 ~ 19695564 (-)
LOC110537275 grl1 other upstream 780043 19924063 ~ 19928533 (-)
G121046 NA other upstream 1067013 20211068 ~ 20212367 (-)
LOC110509624 ret1 other upstream 1318627 20462682 ~ 20465854 (-)

Expression


G119708(LOC106591967) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G119708(LOC106591967) Expression in each Bioproject

Bar chart with 5 bars.
G119708(LOC106591967) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 7.
End of interactive chart.

Co-expression Network