G119955 (LOC106605829)



Basic Information


Item Value
gene id G119955
gene name LOC106605829
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 19710482 ~ 19713435 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU138429
CTGTTTGAGGTTGGAGGTCTGTGAGAAGGACTTGGAGCAGATGGGACAGATGTGAGGGCGCAGGCCAGAGTGGAGCTGACTGTGTCTCCTCAGACAGCTGCTGTTTTTGAAGGACTTGCCACACTCCTGACACACGTAGGGCCGCTCGCCCGTGTGCTGGCGCAGGTGGTACTGGTAGTGGGAGCTCCACTTGAAGGTGAGCGGGCAGTAGGGGCACTGGAAGGTCCGCAGGCCTGTGTGGACGCTACGATGGACCTGGAG

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU138429 True 261 lncRNA 0.36 2 19710482 19713435
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118944064 NA coding upstream 10963 19698491 ~ 19699519 (+)
LOC110537226 LOC106575133 coding upstream 27423 19676656 ~ 19683059 (+)
LOC110537142 LOC106576877 coding upstream 65156 19637434 ~ 19645326 (+)
LOC110537165 LOC106605824 coding upstream 111066 19597513 ~ 19599416 (+)
LOC110537107 LOC106605819 coding upstream 130971 19565879 ~ 19579511 (+)
LOC110537243 LOC106576860 coding downstream 61994 19768270 ~ 19778335 (+)
LOC110537251 LOC106605841 coding downstream 82959 19796394 ~ 19828604 (+)
LOC110537257 LOC106576842 coding downstream 119954 19833389 ~ 19892698 (+)
ecac ecac coding downstream 184884 19898319 ~ 19910352 (+)
LOC110537283 mprd coding downstream 232655 19946090 ~ 19953207 (+)
G119893 NA non-coding upstream 24953 19683793 ~ 19685529 (+)
G119916 LOC106605822 non-coding upstream 115315 19591542 ~ 19595167 (+)
G119909 NA non-coding upstream 128108 19580821 ~ 19582374 (+)
G119883 NA non-coding upstream 147632 19552715 ~ 19562850 (+)
G119866 NA non-coding upstream 190805 19518941 ~ 19519677 (+)
G119986 NA non-coding downstream 45023 19758458 ~ 19758725 (+)
G120018 NA non-coding downstream 106537 19819972 ~ 19821386 (+)
G120031 NA non-coding downstream 136064 19849499 ~ 19850437 (+)
G120032 NA non-coding downstream 136301 19849736 ~ 19850902 (+)
G120048 NA non-coding downstream 166531 19879966 ~ 19881716 (+)
G119952 nat14 other upstream 6694 19702099 ~ 19703788 (+)
LOC110537095 LOC106576906 other upstream 181822 19526163 ~ 19528660 (+)
G119794 u2af2 other upstream 203144 19506651 ~ 19507338 (+)
LOC110503718 LOC102193556 other upstream 452988 19131905 ~ 19259074 (+)
G120059 grl1 other downstream 210637 19924072 ~ 19928477 (+)
casp2 LOC106605831 other downstream 305264 20018602 ~ 20030933 (+)
zyx zyx other downstream 432298 20145710 ~ 20165887 (+)
G120211 NA other downstream 457647 20171082 ~ 20171381 (+)

Expression


G119955(LOC106605829) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G119955(LOC106605829) Expression in each Bioproject

Bar chart with 5 bars.
G119955(LOC106605829) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network