G120209



Basic Information


Item Value
gene id G120209
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 20169800 ~ 20170118 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU138726
gcactgctcaaaaaaataaagggaacacttaaacaacacaatgtaactccaagtcaatcacacttctgtgaaatcaaactgtccacttaggaagcaacactgattgacaatacatttcacatgctgttgtgcaaatggaatagacaacaggtggaaattagaggcaattagcaagacacccccaataaaggagtggttctgcaggtggtgactacagaccacttctcagttcctatgcttcctggctgatgttttggtcacttttgaatgctggcggtgctttcactctagtggtagcatgatacggagtctacaaccc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU138726 True 319 lncRNA 0.43 1 20169800 20170118
Loading

Neighbor


gene id symbol gene type direction distance location
zyx zyx coding upstream 3913 20145710 ~ 20165887 (+)
LOC110534391 clcn1 coding upstream 76083 20031891 ~ 20093717 (+)
casp2 LOC106605831 coding upstream 138867 20018602 ~ 20030933 (+)
LOC110537299 LOC106605834 coding upstream 197820 19963914 ~ 19971980 (+)
LOC110537283 mprd coding upstream 216593 19946090 ~ 19953207 (+)
LOC110537348 LOC106575899 coding downstream 9136 20179254 ~ 20185414 (+)
nop2 LOC106576663 coding downstream 20167 20190285 ~ 20196858 (+)
LOC110537365 LOC106605735 coding downstream 26905 20197023 ~ 20201032 (+)
LOC110534400 ncapd2 coding downstream 32025 20202143 ~ 20228607 (+)
LOC118944183 NA coding downstream 32785 20202903 ~ 20203211 (+)
G120195 NA non-coding upstream 35824 20133774 ~ 20133976 (+)
G120191 NA non-coding upstream 43466 20120912 ~ 20126334 (+)
G120126 NA non-coding upstream 116631 20052669 ~ 20053169 (+)
G120082 NA non-coding upstream 179004 19987403 ~ 19990796 (+)
G120210 NA non-coding downstream 427 20170545 ~ 20170756 (+)
G120212 NA non-coding downstream 1931 20172049 ~ 20172445 (+)
G120213 NA non-coding downstream 3622 20173740 ~ 20174487 (+)
G120184 NA non-coding downstream 41338 20211456 ~ 20212371 (+)
G120059 grl1 other upstream 241323 19924072 ~ 19928477 (+)
LOC110537243 LOC106576860 other upstream 391465 19768270 ~ 19778335 (+)
G119952 nat14 other upstream 466012 19702099 ~ 19703788 (+)
G120211 NA other downstream 964 20171082 ~ 20171381 (+)
G120259 NA other downstream 149621 20319739 ~ 20320256 (+)
G120169 NA other downstream 237744 20407862 ~ 20419128 (+)
erfl3 LOC106576393 other downstream 730156 20900204 ~ 20977481 (+)

Expression


G120209 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G120209 Expression in each Bioproject

Bar chart with 20 bars.
G120209 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network