G120278



Basic Information


Item Value
gene id G120278
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 20405565 ~ 20424397 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU138819
ggggtatgtctctatcagttttgcacatcgagagactgacattttttcccattcctccttgcaaaacagctaaagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttattttttaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatccccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagcgtgatgagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacaacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgcaatatacgactgattgttgtcctatggacagagtctcccacctcagctgtagatctctgcagttcatccagagtgatcatgg

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU138819 True 734 lncRNA 0.39 2 20405565 20424397

Neighbor


gene id symbol gene type direction distance location
LOC110509646 NA coding upstream 33542 20364572 ~ 20372023 (+)
LOC110509663 LOC100194563 coding upstream 41353 20362226 ~ 20364212 (+)
plekhg6 LOC106605732 coding upstream 51719 20338252 ~ 20353846 (+)
LOC110509528 tnr1a coding upstream 67892 20326378 ~ 20337673 (+)
LOC110509548 LOC106575195 coding upstream 94790 20298486 ~ 20310775 (+)
LOC110509563 LOC106576603 coding downstream 28385 20452782 ~ 20462007 (+)
wnt4b wnt4b coding downstream 160912 20585309 ~ 20596873 (+)
LOC110537428 mlf2 coding downstream 184154 20608551 ~ 20612480 (+)
LOC110537439 LOC106576545 coding downstream 191239 20615636 ~ 20628482 (+)
LOC110537453 atn1 coding downstream 204729 20629126 ~ 20649273 (+)
G120272 NA non-coding upstream 48423 20356751 ~ 20357142 (+)
G120271 NA non-coding upstream 49224 20356128 ~ 20356341 (+)
G120270 lag-3 non-coding upstream 49585 20355631 ~ 20355980 (+)
G120269 lag-3 non-coding upstream 49996 20355181 ~ 20355569 (+)
G120289 NA non-coding downstream 29320 20453717 ~ 20454314 (+)
G120285 NA non-coding downstream 38310 20462707 ~ 20464258 (+)
G120317 NA non-coding downstream 112206 20536603 ~ 20542112 (+)
G120318 NA non-coding downstream 114317 20538714 ~ 20540302 (+)
G120342 NA non-coding downstream 154898 20579295 ~ 20579761 (+)
G120259 NA other upstream 85309 20319739 ~ 20320256 (+)
LOC110537348 LOC106575899 other upstream 220940 20179254 ~ 20185414 (+)
G120211 NA other upstream 234184 20171082 ~ 20171381 (+)
zyx zyx other upstream 248455 20145710 ~ 20165887 (+)
casp2 LOC106605831 other upstream 380582 20018602 ~ 20030933 (+)
erfl3 LOC106576393 other downstream 475877 20900204 ~ 20977481 (+)
LOC110509768 LOC106576258 other downstream 567357 20990131 ~ 21058856 (+)
LOC118938333 LOC106605563 other downstream 1117700 21532987 ~ 21547038 (+)
G121677 NA other downstream 1161024 21585421 ~ 21586101 (+)
LOC110537735 LOC106595974 other downstream 1396817 21821165 ~ 21825285 (+)

Expression


G120278 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G120278 Expression in each Bioproject

Bar chart with 21 bars.
G120278 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network