G121312



Basic Information


Item Value
gene id G121312
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 20867293 ~ 20867528 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU140093
GAGTCAGCATGTTCAGGTTCAGTTGAAGCATTATACAGATAATCACATAGCAATAGAAAAAATGGAAGGTGCAAATGCTTTTGGTTGATGCTACGGCGCTGAAATATGATGTCACACTGCAGTATTGGCTTTTGTATATGCGGTGATATGTTTTGCTGTGCAGCCTCCGTTCATTCTTTCCTATATGTACAGAGGTGTTTGTTGGGTCTAACAATAGGCCCTACAGAGGTTTGAGT

Function


NR:

description
PREDICTED: adenylosuccinate synthetase isozyme 2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU140093 True 236 lncRNA 0.41 1 20867293 20867528
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110537483 LOC106605857 coding downstream 178438 20673776 ~ 20688855 (-)
LOC110537475 LOC106605848 coding downstream 194015 20668568 ~ 20673278 (-)
LOC110537468 LOC106605860 coding downstream 202074 20662992 ~ 20665219 (-)
LOC110537462 LOC106576526 coding downstream 206306 20651234 ~ 20660987 (-)
LOC110537423 LOC105029961 coding downstream 264805 20597056 ~ 20602488 (-)
LOC110509793 LOC106576373 coding upstream 196539 21064067 ~ 21074205 (-)
LOC110537544 LOC106605712 coding upstream 454485 21322013 ~ 21348882 (-)
LOC110534425 LOC106605569 coding upstream 508898 21376426 ~ 21379023 (-)
LOC110537611 NA coding upstream 685990 21553518 ~ 21555867 (-)
LOC118938339 LOC106605559 coding upstream 710621 21578149 ~ 21586856 (-)
G121310 NA non-coding downstream 3381 20863354 ~ 20863912 (-)
G121286 NA non-coding downstream 69239 20797394 ~ 20798054 (-)
G121209 NA non-coding downstream 171903 20694369 ~ 20695390 (-)
G121238 NA non-coding downstream 223471 20641755 ~ 20643822 (-)
G121314 NA non-coding upstream 3073 20870601 ~ 20870931 (-)
G121315 NA non-coding upstream 4612 20872140 ~ 20872704 (-)
G121317 NA non-coding upstream 20671 20888199 ~ 20890259 (-)
G121372 NA non-coding upstream 104199 20971727 ~ 20973710 (-)
G121371 NA non-coding upstream 106760 20974288 ~ 20974648 (-)
G121208 NA other downstream 239593 20626557 ~ 20627700 (-)
G121188 NA other downstream 366706 20498896 ~ 20500587 (-)
LOC110509624 ret1 other downstream 401504 20462682 ~ 20465854 (-)
G121046 NA other downstream 654926 20211068 ~ 20212367 (-)
LOC110537275 grl1 other downstream 938833 19924063 ~ 19928533 (-)
G121421 LOC106576258 other upstream 189070 21056598 ~ 21058849 (-)
G121533 LOC106583873 other upstream 421088 21288616 ~ 21346687 (-)
G121738 NA other upstream 595165 21462693 ~ 21463030 (-)
G121756 NA other upstream 622739 21490267 ~ 21547037 (-)
G122733 LOC106592382 other upstream 928979 21796507 ~ 21812432 (-)

Expression


G121312 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G121312 Expression in each Bioproject

Bar chart with 8 bars.
G121312 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network