G121754



Basic Information


Item Value
gene id G121754
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 21483135 ~ 21485499 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU140626
GTTCACGATCAGTCTATAGTTTGGGCTGGTCATGTTACTAAGGGGGTTAGAAGCAGAACACTGATAGTCTCCGTTGTCAGAATGCTGTAATGAGTTGAATGTCAGTGTATTGTTGTTCATAGAGAAGTCTGTTCTGTTGTCAGCATACAGAGGCCAGCCGTTCCTCATCCACTGAATGGAGTAAACCGTTCCAGCGGTGCCACAGGTCAGAGAGAATCTCTCGTTCAGTATTGGCTGGGCTCCAATGACTTTCACCATGGTCATGGTCACAGGTTC

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU140626 True 276 lncRNA 0.47 2 21483135 21485499

Neighbor


gene id symbol gene type direction distance location
LOC110534425 LOC106605569 coding downstream 104112 21376426 ~ 21379023 (-)
LOC110537544 LOC106605712 coding downstream 134253 21322013 ~ 21348882 (-)
LOC110509793 LOC106576373 coding downstream 408930 21064067 ~ 21074205 (-)
LOC110537483 LOC106605857 coding downstream 794280 20673776 ~ 20688855 (-)
LOC110537475 LOC106605848 coding downstream 809857 20668568 ~ 20673278 (-)
LOC110537611 NA coding upstream 68019 21553518 ~ 21555867 (-)
LOC118938339 LOC106605559 coding upstream 92650 21578149 ~ 21586856 (-)
LOC110534443 LOC106605563 coding upstream 101479 21586978 ~ 21594470 (-)
LOC118944069 LOC106605559 coding upstream 109737 21595236 ~ 21596535 (-)
LOC110534450 LOC106605556 coding upstream 145891 21631390 ~ 21633645 (-)
G121739 NA non-coding downstream 19864 21463050 ~ 21463271 (-)
G121575 NA non-coding downstream 47942 21383008 ~ 21435193 (-)
G121584 NA non-coding downstream 59744 21408505 ~ 21423391 (-)
G121590 NA non-coding downstream 66188 21416552 ~ 21416947 (-)
G121571 NA non-coding downstream 101093 21381736 ~ 21382042 (-)
G121756 NA non-coding upstream 5057 21490267 ~ 21547037 (-)
G121826 NA non-coding upstream 144269 21629768 ~ 21663939 (-)
G121848 NA non-coding upstream 182720 21668219 ~ 21671696 (-)
G121851 NA non-coding upstream 187289 21672788 ~ 21673005 (-)
G121738 NA other downstream 20105 21462693 ~ 21463030 (-)
G121533 LOC106583873 other downstream 136448 21288616 ~ 21346687 (-)
G121421 LOC106576258 other downstream 424286 21056598 ~ 21058849 (-)
G121208 NA other downstream 855435 20626557 ~ 20627700 (-)
G121188 NA other downstream 982548 20498896 ~ 20500587 (-)
G122733 LOC106592382 other upstream 311008 21796507 ~ 21812432 (-)
G122761 LOC106578847 other upstream 365934 21851433 ~ 21856413 (-)
G122829 LOC106605673 other upstream 540800 22026299 ~ 22027717 (-)
LOC110537842 NA other upstream 635081 22120579 ~ 22157534 (-)

Expression


G121754 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 150.
End of interactive chart.

G121754 Expression in each Bioproject

Bar chart with 6 bars.
G121754 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 800.
End of interactive chart.

Co-expression Network