G121898



Basic Information


Item Value
gene id G121898
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 21709313 ~ 21710578 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU140792
gggggcgccaacccagacaggatgaccacatcagtgactcaacccactcaggtgacgcaccccctccagggacggcatgagagagccccagtaaagccagtgactcagcccctgtaatagggttagaggcagagaatccaagtggaaagaggggaaccggccaggcagagacagcaagggtggttcgttgctccagagcctttccgttcaccctcccactcctgggccagactacactcaatcatatgacccactgaagagatgagtcttcagtagagacttaaaggttgagaccgagtttgcgtctctgacatgggtaggcagaccgttccataaaaatggagctctataggagaaagccctgcctccagctgtttgcttaaaaattctagggacaattaggaggcctgcgtcttgtgaccgtagcgtatgtgtaggtatgtacggcaggaccaaatcagagagatagataggagcaagcccatgtaatgctttgtaggttagcagtaaaaccttgaaatcagcccttgctttgacaggaagccagtgtagagaggctagcactggagtaatatgatcaaattttttggttctagtcaggattctagcagccgtatttagcactaactgaagtttatttagtgctttatccgggtagccggaaagtagagcattgcagtagtctaacctggaagtgacaaaagcatggattaatttttctgcatcatttttggacagaaagttcctgatttttgcaatgttacgtagatggaaaaaagctgtccttaaaatggtcttgatatgttcttcaaaagagagatcagggtccagagtaacgccgaggtccttcacagttttatttgagacgactgtacaaccattaagattaattgtcagattcaacagaagatctctttgtttcttgggacctagaacaagcatctctgttttgtccgagtttaaaagtagaaagtttgcagccatccacttccttatgtctgaaacacattcttctagcaagggcaattttggggcttcaccatgtttaattgaaatgtacagctgtgtgtcatccgcatagcagtgaaagttaacattatgttttcgaataacatccccaagaggtaaaatatatagtgaaaacaatagtggtcctaaaacggaaccttgaggaacaccgaaatttacagttgatttgtcagaggacagaccattcacagagacaaactgatatctttccgacagataagatctaaaccaggccag

Function


NR:

description
ORF2 protein

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU140792 True 1266 lncRNA 0.45 1 21709313 21710578

Neighbor


gene id symbol gene type direction distance location
LOC110537629 LOC106578808 coding upstream 952 21705264 ~ 21708361 (+)
LOC110514317 LOC106578808 coding upstream 4550 21698295 ~ 21704763 (+)
LOC110537622 LOC106605554 coding upstream 32393 21671490 ~ 21676920 (+)
LOC110537595 LOC106605558 coding upstream 138950 21555905 ~ 21570363 (+)
LOC118938333 LOC106605563 coding upstream 162275 21532987 ~ 21547038 (+)
LOC110537775 LOC106605724 coding downstream 26171 21736749 ~ 21742169 (+)
LOC110537646 LOC106574911 coding downstream 46715 21757293 ~ 21804410 (+)
LOC110537766 LOC106592382 coding downstream 82946 21793524 ~ 21799614 (+)
LOC110537864 LOC106605571 coding downstream 90754 21801332 ~ 21803861 (+)
LOC110537743 LOC106605572 coding downstream 95033 21805611 ~ 21812352 (+)
G121884 NA non-coding upstream 12311 21696636 ~ 21697002 (+)
G121877 NA non-coding upstream 15337 21693761 ~ 21693976 (+)
G121866 NA non-coding upstream 24516 21684591 ~ 21684797 (+)
G121861 NA non-coding upstream 26500 21682549 ~ 21682813 (+)
G121732 NA non-coding upstream 36583 21672401 ~ 21672730 (+)
G121897 NA non-coding downstream 1010 21711588 ~ 21712136 (+)
G121920 NA non-coding downstream 17896 21728474 ~ 21728737 (+)
G121930 NA non-coding downstream 87773 21798351 ~ 21812247 (+)
LOC110537720 LOC106578847 non-coding downstream 138796 21849271 ~ 21853703 (+)
G121677 NA other upstream 123212 21585421 ~ 21586101 (+)
LOC110509768 LOC106576258 other upstream 693422 20990131 ~ 21058856 (+)
erfl3 LOC106576393 other upstream 733114 20900204 ~ 20977481 (+)
G120169 NA other upstream 1290185 20407862 ~ 20419128 (+)
LOC110537735 LOC106595974 other downstream 110636 21821165 ~ 21825285 (+)
G122030 NA other downstream 306084 22015130 ~ 22018815 (+)
LOC110537939 apoc1 other downstream 631949 22342491 ~ 22346615 (+)
apoc4 NA other downstream 638005 22348543 ~ 22349936 (+)
G122459 LOC106578191 other downstream 1100189 22810767 ~ 22811263 (+)

Expression


G121898 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G121898 Expression in each Bioproject

Bar chart with 20 bars.
G121898 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network