G125683 (cep162)


Basic Information

Item Value
gene id G125683
gene name cep162
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 25429742 ~ 25430246 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU145160
TTGCAGCACACTGATGAACGAACTTGTTGCATCACAGACTGAAAAACTACTCCAGTATGTTGACTTACTTTCCTCTCTGATGGACACTCAGTCTCCTGAGTCTGGCTGGCTTCCTGTTGACCTTTGGTTTCCCAGGAGACAGTGTGACTGGTATCCTGGTGACCTCTCATCTTCATCTGATGTTGCTGCTGGAGGAAGGCAGCGAAGGACTGAACCACTGCCACCAGCTCGCTGCTCACACTCAGACCACCACAGTCTGGACTTAAAGAACAACCACACATCAACATTTAGCCAACATTAAGGCGGCGAAGGACTGACACCCACCATCAGACCACCACAGGCTGGACCTGGTAGAAGTACAACCACATAGCAACATCAGTCTGTATCAGGAGTACAACCACACAGCAACTTTAGTCTGGATCAGGAGTTCAACCACACAGCAACATTAGTCTGATCAGGAGTCCAACCACACAGCAAAATTAGTCTGGATCAGAAGTTCAACCAC

Function

symbol description
cep162 Acts upstream of or within cilium assembly and heart looping. Predicted to be located in cytoplasm and microtubule. Predicted to be active in axonemal microtubule; centriole; and centrosome. Is expressed in head. Orthologous to human CEP162 (centrosomal protein 162).

NR:

description
PREDICTED: centrosomal protein of 162 kDa isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU145160 True 505 lncRNA 0.49 1 25429742 25430246

Neighbor

gene id symbol gene type direction distance location
LOC110539045 mrap2 coding upstream 15367 25403433 ~ 25414375 (+)
LOC110534557 LOC106605501 coding upstream 33408 25377221 ~ 25396334 (+)
LOC110534548 LOC106579462 coding upstream 104086 25294643 ~ 25325656 (+)
ascc3 ascc3 coding upstream 138218 25151016 ~ 25291524 (+)
LOC110538989 NA coding upstream 706369 24685282 ~ 24723373 (+)
tsnare1 LOC106605505 coding downstream 401157 25831403 ~ 25974877 (+)
LOC110539113 LOC106605506 coding downstream 668897 26099143 ~ 26113953 (+)
cdk14 LOC106605507 coding downstream 693467 26123713 ~ 26330981 (+)
fzd1 LOC106605515 coding downstream 892761 26323007 ~ 26326895 (+)
LOC110539173 LOC106605512 coding downstream 1022435 26452681 ~ 26547503 (+)
G125675 cep162 non-coding upstream 7123 25422012 ~ 25422619 (+)
G125668 NA non-coding upstream 12242 25417120 ~ 25417500 (+)
G124711 NA non-coding upstream 57075 25372448 ~ 25372667 (+)
G124706 NA non-coding upstream 66673 25362838 ~ 25363069 (+)
G124705 NA non-coding upstream 67731 25361782 ~ 25362011 (+)
G125684 NA non-coding downstream 1954 25432200 ~ 25432435 (+)
G125685 NA non-coding downstream 3136 25433382 ~ 25433602 (+)
G125686 NA non-coding downstream 3518 25433764 ~ 25433978 (+)
G125724 LOC106605502 non-coding downstream 29380 25459626 ~ 25460855 (+)
G125729 NA non-coding downstream 34856 25465102 ~ 25465351 (+)
G124451 LOC106578403 other upstream 555908 24873051 ~ 24873834 (+)
LOC110538915 LOC106605649 other upstream 885516 24540963 ~ 24544247 (+)
G124121 LOC106605585 other upstream 1281149 24146861 ~ 24148593 (+)
LOC110538497 LOC106605627 other upstream 1548106 23861576 ~ 23881639 (+)
G125934 NA other downstream 252634 25682880 ~ 25757853 (+)
G126387 LOC105417071 other downstream 619604 26049850 ~ 26050104 (+)
G126727 LOC106581475 other downstream 1196603 26626849 ~ 26628649 (+)
G127190 cf113 other downstream 1363964 26794210 ~ 26795762 (+)
G127198 LOC106605538 other downstream 1427452 26857698 ~ 26861242 (+)

Expression


Co-expression Network