G127702 (ubr5)


Basic Information

Item Value
gene id G127702
gene name ubr5
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 27270133 ~ 27270723 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU147336
CGTCTGAAGGAGGGGTAGCCAAAGTAGCTGATGTCCTCAGAGAACATGGCGTCAGCATCGATGATGACACTGGGGTGGGCTGAGTGGATGTCAGCATCCAGCAGGGACATCAGGTCCTCTCCAGGGAGGTAGGACTCGCTGGCTGTGTCATCGCCATCGTCACCGTCCTCATCGTCTCTGCTCAGTAGGTTGTTGACGGCCAGGTTGACATCCAGGTTGGTCCTCTGGAGCTCCCGGATGATCACACTCCTAGACTTCCCCTGAAGGACCACCTGAGC

Function

symbol description
ubr5 Predicted to enable several functions, including ubiquitin binding activity; ubiquitin-protein transferase activity; and zinc ion binding activity. Predicted to be involved in several processes, including negative regulation of histone H2A K63-linked ubiquitination; protein polyubiquitination; and regulation of double-strand break repair. Predicted to be active in nucleus. Human ortholog(s) of this gene implicated in invasive ductal carcinoma. Orthologous to human UBR5 (ubiquitin protein ligase E3 component n-recognin 5).

NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU147336 True 278 lncRNA 0.42 2 27270133 27270723

Neighbor

gene id symbol gene type direction distance location
LOC110485224 rn146 coding upstream 87574 27178987 ~ 27182559 (+)
LOC110485212 LOC106605536 coding upstream 94386 27147880 ~ 27175747 (+)
LOC110485187 LOC106605537 coding upstream 335655 26917395 ~ 26934478 (+)
LOC110533712 NA coding upstream 360966 26904901 ~ 26909167 (+)
LOC110485145 LOC106579269 coding upstream 366722 26897929 ~ 26903411 (+)
LOC110485466 LOC106605529 coding downstream 17449 27288172 ~ 27303644 (+)
LOC110485500 LOC106579140 coding downstream 50827 27321550 ~ 27331169 (+)
LOC110485507 LOC106579115 coding downstream 60974 27331697 ~ 27380409 (+)
LOC110485543 LOC106579099 coding downstream 119867 27390590 ~ 27403425 (+)
LOC110485528 LOC106605545 coding downstream 132942 27403665 ~ 27408989 (+)
G127608 NA non-coding upstream 128623 27141213 ~ 27141510 (+)
G127571 NA non-coding upstream 157620 27112208 ~ 27112513 (+)
G127517 NA non-coding upstream 215282 27054632 ~ 27054851 (+)
G127513 NA non-coding upstream 219464 27050337 ~ 27050669 (+)
G127503 NA non-coding upstream 225399 27044496 ~ 27044734 (+)
G127709 NA non-coding downstream 9795 27280518 ~ 27280720 (+)
G127712 NA non-coding downstream 12667 27283390 ~ 27283688 (+)
G127697 LOC106605528 non-coding downstream 37805 27308528 ~ 27310040 (+)
G127699 LOC106605528 non-coding downstream 39844 27310567 ~ 27312496 (+)
G127767 NA non-coding downstream 117819 27388542 ~ 27388818 (+)
G127644 LOC106605534 other upstream 79540 27189991 ~ 27190593 (+)
G127198 LOC106605538 other upstream 408891 26857698 ~ 26861242 (+)
G127190 cf113 other upstream 474371 26794210 ~ 26795762 (+)
G126727 LOC106581475 other upstream 641484 26626849 ~ 26628649 (+)
G128185 NA other downstream 445759 27716482 ~ 27717163 (+)
G128436 NA other downstream 817924 28088647 ~ 28089445 (+)
G128490 NA other downstream 980119 28250842 ~ 28547915 (+)
LOC110485990 LOC106579931 other downstream 1661333 28931988 ~ 28951235 (+)

Expression


Co-expression Network