G131957



Basic Information


Item Value
gene id G131957
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 31560610 ~ 31561380 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU152018
CACTTCAGTTTAGACAAACACAATGTTCTCAGTGGTAACACTTCAGTTTAGACAAACACAATGTTCTCAGTGGTAACACTTCAGTTTAGACAAACACGATGTTCTCAGTGGTAACACTTCAGTTTAGACACACACAATGTTCTCAGTGGTAACACTTCAGTTTAGACACACACAATGTTCTCAGTGGTAACACTTCAGTTTAGACAAACAATGTTCTCAGTGGTAACACTTCAGTTTAGACACACACAATGTTCTCAGTGGTAACACTTCAGTTTAGACAAACACAATGTTCTCAGTGGTAACACTTCAGTTTAGACAAACACAATGTTCTCAGTGGTAACACTTCAGTTTAGACACACAATGTTCTCAGTGGTAACACTTCAGTTTAGACAAACACAATGTTCTCAGTGGTAACACTTCAGTTTAGACAAACACCATGTTCTCAGTGGTAACACTTCAGTTTAGACAAACACAATGTTCT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU152018 True 481 lncRNA 0.38 3 31560610 31561380
Loading

Neighbor


gene id symbol gene type direction distance location
eaf1 LOC106581241 coding upstream 194288 31360408 ~ 31366322 (+)
LOC110486933 can7 coding upstream 244697 31300002 ~ 31315913 (+)
LOC110534710 LOC106605356 coding upstream 266033 31262054 ~ 31294577 (+)
mxtx2 NA coding upstream 299480 31255824 ~ 31261130 (+)
LOC110486889 NA coding upstream 338531 31208985 ~ 31222079 (+)
LOC110486995 atg5 coding downstream 28094 31589474 ~ 31624014 (+)
LOC110534719 LOC106605346 coding downstream 280358 31841738 ~ 31857595 (+)
LOC110487037 LOC106605342 coding downstream 352300 31913680 ~ 31933154 (+)
LOC110487045 LOC106581064 coding downstream 380586 31941966 ~ 31974601 (+)
LOC110487089 LOC106581052 coding downstream 423979 31985359 ~ 31987549 (+)
G131946 NA non-coding upstream 21173 31539012 ~ 31539437 (+)
G131925 NA non-coding upstream 48468 31509542 ~ 31512142 (+)
G131923 NA non-coding upstream 55765 31504637 ~ 31504845 (+)
G131918 NA non-coding upstream 74179 31486185 ~ 31486431 (+)
G131917 NA non-coding upstream 75470 31484896 ~ 31485140 (+)
G131968 NA non-coding downstream 15687 31577067 ~ 31578629 (+)
G131970 NA non-coding downstream 30760 31592140 ~ 31592593 (+)
G131983 NA non-coding downstream 65615 31626995 ~ 31627345 (+)
G131988 prdm1 non-coding downstream 70584 31631964 ~ 31633994 (+)
G131998 NA non-coding downstream 96027 31657407 ~ 31657610 (+)
G131517 ccne2 other upstream 810656 30748055 ~ 30749954 (+)
G131491 NA other upstream 859987 30700182 ~ 30700623 (+)
G130414 NA other upstream 1770779 29789576 ~ 29789831 (+)
G132342 LOC100136303 other downstream 296268 31834170 ~ 31887572 (+)
G133473 LOC106605294 other downstream 1606058 33167438 ~ 33169378 (+)
G133663 LOC106605282 other downstream 1935074 33496454 ~ 33497285 (+)
G133760 LOC106605274 other downstream 2252653 33814033 ~ 33814483 (+)
G134735 LOC100136012 other downstream 2401037 33962417 ~ 33962658 (+)

Expression


G131957 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G131957 Expression in each Bioproject

Bar chart with 9 bars.
G131957 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network