G134668



Basic Information


Item Value
gene id G134668
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 33865488 ~ 33865937 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU155089
ctgcctgtgtataatggtttctagcttccctgaacagctgcatatcacgggggctgtttgatgctaatgcagaacgccataggatgtttttgtgttggttaagggcagtcaggtctggggagaaccaagggctatatctgttcctggttctaaatttcttgaatggggcatgtttatttaagatggttaggaaggcatttaaaaaaaatatccaggcatcctctactgacgggatgaggtcaatatccttccaggataccccgaccaggtcgattagaaaggcctgctcgctgaagtgtttcagggagcgttttacagtgatgagaggaggtcgtttgaccgctgacccattacggatgcaggcaatgaggcagtgatcgctgagatcttggttgaagacagcagaggtgtatttagaggggaagttggttaggataatatctatgaggg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU155089 True 450 TUCP 0.47 1 33865488 33865937

Neighbor


gene id symbol gene type direction distance location
LOC110487899 LOC106605274 coding downstream 14723 33779193 ~ 33850765 (-)
LOC110487833 LOC106581966 coding downstream 133044 33725770 ~ 33732444 (-)
LOC110487821 LOC106605277 coding downstream 149841 33712265 ~ 33715647 (-)
LOC110487810 LOC106605280 coding downstream 160691 33695017 ~ 33704797 (-)
LOC110487773 LOC106605251 coding downstream 202867 33648123 ~ 33662621 (-)
LOC110487942 LOC106582030 coding upstream 208618 34074555 ~ 34134234 (-)
LOC110534769 efhb coding upstream 304808 34170745 ~ 34171718 (-)
LOC110534780 pp2d1 coding upstream 320117 34186054 ~ 34188011 (-)
LOC110488012 LOC106605268 coding upstream 327722 34193659 ~ 34234849 (-)
nek10 nek10 coding upstream 504879 34370816 ~ 34384026 (-)
G134635 NA non-coding downstream 55693 33809574 ~ 33809795 (-)
G134619 NA non-coding downstream 76284 33788826 ~ 33789204 (-)
G134562 NA non-coding downstream 106709 33725521 ~ 33758779 (-)
G134557 tap1 non-coding downstream 118803 33742952 ~ 33746685 (-)
syngap1b LOC106605281 non-coding downstream 325665 33523035 ~ 33590990 (-)
G134669 NA non-coding upstream 371 33866308 ~ 33866913 (-)
G134680 NA non-coding upstream 13368 33879305 ~ 33880423 (-)
G134739 LOC106600457 non-coding upstream 99570 33965507 ~ 33965740 (-)
G134770 NA non-coding upstream 123303 33989240 ~ 33989446 (-)
G134811 NA non-coding upstream 151593 34017530 ~ 34017837 (-)
LOC110487618 LOC100380645 other downstream 640386 33208500 ~ 33225125 (-)
G134102 NA other downstream 1077367 32748208 ~ 32788121 (-)
LOC110514821 NA other downstream 1113910 32738829 ~ 32756992 (-)
LOC110486999 prdm1 other downstream 2216693 31631886 ~ 31648795 (-)
G132197 NA other downstream 2322479 31536047 ~ 31543009 (-)
G135575 NA other upstream 738278 34604215 ~ 34604478 (-)
G136399 psmc4 other upstream 1440430 35306367 ~ 35307729 (-)
drd2l LOC106582624 other upstream 1808361 35674291 ~ 35700846 (-)
G137479 NA other upstream 2504067 36370004 ~ 36370328 (-)
G137839 LOC106605146 other upstream 2768256 36634193 ~ 36639005 (-)

Expression


G134668 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G134668 Expression in each Bioproject

Bar chart with 20 bars.
G134668 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network